ID: 981040077

View in Genome Browser
Species Human (GRCh38)
Location 4:140214669-140214691
Sequence GCAAGTCCTGCTTTTCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981040068_981040077 -1 Left 981040068 4:140214647-140214669 CCCTTCTCCTTCACCCTTAGCGG 0: 201
1: 360
2: 460
3: 354
4: 240
Right 981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG No data
981040071_981040077 -8 Left 981040071 4:140214654-140214676 CCTTCACCCTTAGCGGCAAGTCC 0: 457
1: 585
2: 275
3: 104
4: 106
Right 981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG No data
981040067_981040077 0 Left 981040067 4:140214646-140214668 CCCCTTCTCCTTCACCCTTAGCG 0: 202
1: 356
2: 150
3: 62
4: 232
Right 981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG No data
981040066_981040077 6 Left 981040066 4:140214640-140214662 CCTCAACCCCTTCTCCTTCACCC 0: 458
1: 207
2: 56
3: 137
4: 1396
Right 981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG No data
981040065_981040077 7 Left 981040065 4:140214639-140214661 CCCTCAACCCCTTCTCCTTCACC 0: 375
1: 236
2: 100
3: 101
4: 1002
Right 981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG No data
981040070_981040077 -2 Left 981040070 4:140214648-140214670 CCTTCTCCTTCACCCTTAGCGGC 0: 197
1: 354
2: 164
3: 42
4: 162
Right 981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981040077 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG Intergenic
No off target data available for this crispr