ID: 981041637

View in Genome Browser
Species Human (GRCh38)
Location 4:140228244-140228266
Sequence ATGAAGAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981041637_981041643 -7 Left 981041637 4:140228244-140228266 CCCTCCTCCTCCTCCTTCTTCAT No data
Right 981041643 4:140228260-140228282 TCTTCATATTATTCTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981041637 Original CRISPR ATGAAGAAGGAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr