ID: 981043005

View in Genome Browser
Species Human (GRCh38)
Location 4:140240422-140240444
Sequence AGGTGACGCGAGGTCACCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981043001_981043005 6 Left 981043001 4:140240393-140240415 CCAACAGATGGAGAAACTGAAGC No data
Right 981043005 4:140240422-140240444 AGGTGACGCGAGGTCACCGAGGG No data
981043000_981043005 9 Left 981043000 4:140240390-140240412 CCACCAACAGATGGAGAAACTGA No data
Right 981043005 4:140240422-140240444 AGGTGACGCGAGGTCACCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981043005 Original CRISPR AGGTGACGCGAGGTCACCGA GGG Intergenic
No off target data available for this crispr