ID: 981043204

View in Genome Browser
Species Human (GRCh38)
Location 4:140242143-140242165
Sequence TTCCAAATGTCACCAATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981043203_981043204 21 Left 981043203 4:140242099-140242121 CCATACATATTGTGTTGTTAAAT No data
Right 981043204 4:140242143-140242165 TTCCAAATGTCACCAATCCCTGG No data
981043202_981043204 24 Left 981043202 4:140242096-140242118 CCACCATACATATTGTGTTGTTA No data
Right 981043204 4:140242143-140242165 TTCCAAATGTCACCAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981043204 Original CRISPR TTCCAAATGTCACCAATCCC TGG Intergenic
No off target data available for this crispr