ID: 981045560

View in Genome Browser
Species Human (GRCh38)
Location 4:140261858-140261880
Sequence ATGTGTGACCAGGGCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981045555_981045560 8 Left 981045555 4:140261827-140261849 CCGGTGAAGATGACCAGCAAGGA 0: 1
1: 0
2: 0
3: 13
4: 163
Right 981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 228
981045556_981045560 -5 Left 981045556 4:140261840-140261862 CCAGCAAGGAGTTAGAGAATGTG 0: 1
1: 1
2: 4
3: 9
4: 141
Right 981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981045560 Original CRISPR ATGTGTGACCAGGGCTTGGA AGG Intronic
900370862 1:2331518-2331540 ATGGGTGACCAAGCCCTGGAGGG + Intronic
901379321 1:8862510-8862532 ATGTGGAGCCAGGGCTGGGAGGG - Intronic
901455192 1:9359162-9359184 ATGTCTGACCAGGACTTGCTGGG - Intronic
902046025 1:13525150-13525172 ATGGCTGACCAGGGTTTTGAAGG + Intergenic
902604724 1:17562739-17562761 ATGTGTGCCCAGACCTTTGAAGG + Intronic
904037276 1:27565523-27565545 ATGTTTGTCCAGGGCATGGGTGG - Intronic
906045734 1:42829700-42829722 ATTTGTGGCCAGTGCTTGGCAGG + Intronic
906381480 1:45334751-45334773 CTGTGAGGCCAGGGCTGGGATGG + Intronic
907877102 1:58501707-58501729 ATGTGTGAGCAGAGATGGGAGGG - Intronic
908449404 1:64236982-64237004 ATGTGCAACCAAGGCTGGGAAGG + Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910669870 1:89762334-89762356 GTGTGTGGGCAGGGCTAGGAAGG - Intronic
912448193 1:109753031-109753053 TTGTGTGACCATGGTTTGGATGG + Intronic
912591985 1:110831604-110831626 ATGATTGCCTAGGGCTTGGAGGG + Intergenic
912725781 1:112057846-112057868 ATGAGTATCCAGGGCTTTGAAGG - Intergenic
913239287 1:116815183-116815205 CTGTGTGGCCAAGGCCTGGAGGG - Intergenic
915515307 1:156409304-156409326 ATGTATGAGCAGGGGATGGAAGG + Intronic
918124720 1:181572993-181573015 ATGTTTGCCCAGTGCTGGGAGGG - Intronic
919376698 1:196803607-196803629 ATGTGTGACAAAGGTTTTGATGG - Intergenic
919386406 1:196928499-196928521 ATGTGTGACAAAGGTTTTGATGG - Intronic
919920349 1:202163449-202163471 GTGTGTGGCCAGAGCTTGGGAGG - Intergenic
921173125 1:212566564-212566586 AACTGTGACCAGGGCATAGAGGG + Intronic
921551274 1:216538270-216538292 GTGTGTGCCCAGAACTTGGAAGG + Intronic
922503365 1:226112348-226112370 CTGTGTGACCAGGACATGGGTGG - Intergenic
924904308 1:248434972-248434994 ATGTGTGAGCAGGGCTGGGTAGG + Intergenic
924923583 1:248657074-248657096 ATGTGTGAGCAGGGCTGGGTAGG - Intergenic
1062968546 10:1628828-1628850 AAGTGGGACCAGGGCCTGGCCGG - Intronic
1066424183 10:35290917-35290939 TTGTGTGCCCAGGGCTGGAAAGG - Intronic
1066449475 10:35515251-35515273 ATGTGAGACTAGGGCTCCGAGGG + Intronic
1066639941 10:37545883-37545905 ATGGGCAACCGGGGCTTGGATGG - Intergenic
1067792979 10:49301718-49301740 CTGTCTGACCTGGGCTTAGAAGG - Intronic
1068843309 10:61640432-61640454 TTTTATGAGCAGGGCTTGGAGGG + Intergenic
1069631847 10:69902027-69902049 GTGTGTGAGAAGGGCTAGGAGGG + Intronic
1069812775 10:71174802-71174824 GTGGGAGACCAGGGCTTGGCAGG - Intergenic
1071295735 10:84217948-84217970 AAGTGTGATCAGAGCTGGGAAGG + Intronic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072767808 10:98109904-98109926 ACGTGTGACCATGGCTTGTTCGG + Intergenic
1073008699 10:100343553-100343575 GTGGTTGCCCAGGGCTTGGAAGG - Intergenic
1073243978 10:102076517-102076539 AGGGGTGACCAGGGCTTGACAGG - Intergenic
1077410654 11:2402449-2402471 AGGTGAGAGGAGGGCTTGGAGGG + Exonic
1081869844 11:46378348-46378370 ATGTGTGCCCAGGGCTCCGTTGG - Intronic
1082013794 11:47469348-47469370 TTGAGTGGCCAGGGCCTGGATGG - Intronic
1084036316 11:66513193-66513215 ATGTGTGAACTGGGCATTGAAGG + Intronic
1084322967 11:68383840-68383862 CTGTGTGACCTGGGCCTTGAAGG + Intronic
1085269563 11:75262284-75262306 ATGTGACACCAGGCCTAGGAGGG + Intergenic
1085670303 11:78457962-78457984 GTGTGTAACGGGGGCTTGGAAGG + Intronic
1088505315 11:110521792-110521814 AAGTGTGGACAGGGCCTGGATGG + Intergenic
1088864574 11:113835571-113835593 CTCTGGGACCAGGGCTTGGCTGG + Intronic
1094715164 12:33006555-33006577 ATTTGTTTCCAGGGTTTGGAGGG - Intergenic
1098061518 12:66568291-66568313 ATTGGTGACCAGGGATTGAACGG - Intronic
1099693778 12:85993489-85993511 ATGGTAGACCAGGGATTGGATGG + Intronic
1100958908 12:99940798-99940820 AAGTGGGACCAGAGCTTAGAGGG + Intronic
1101511919 12:105400954-105400976 ATGTGTGACCCTGGCTTCTATGG - Intergenic
1101518382 12:105459033-105459055 TTTTATGACCTGGGCTTGGAAGG + Intergenic
1102857952 12:116311231-116311253 ATGTCAGACCAGGTCTTGCAAGG + Intergenic
1103323681 12:120106170-120106192 ATCTGTGTTCAGTGCTTGGAGGG - Intronic
1104919984 12:132285656-132285678 AGGTGGGACCAGGGCTGGCAGGG + Intronic
1105434512 13:20364947-20364969 GTGTGTAACCACAGCTTGGAAGG + Intergenic
1108473607 13:50791201-50791223 ATGTGTCCCCTGGGCTTGGCTGG + Intronic
1108494295 13:51008754-51008776 CTGGGTGACTAGGGCTTGAATGG - Intergenic
1109206950 13:59493012-59493034 AAGTGTGACCTGGGTTAGGATGG - Intergenic
1110310974 13:74048658-74048680 ATGTTTTACCAGGGCTTTGTTGG - Intronic
1112665502 13:101567728-101567750 AAGTGTGACCAGGGATGGTATGG + Exonic
1113749572 13:112767950-112767972 TTCTGTGACCAGCGCTTGGTGGG - Intronic
1114036107 14:18629300-18629322 ATGTGTAAGCAGGTCTTGGTGGG + Intergenic
1114122530 14:19685731-19685753 ATGTGTAAGCAGGTCTTGGTGGG - Intergenic
1119668338 14:76500086-76500108 AGGTGGGACCAGGGCTTCTATGG - Intronic
1119758727 14:77136703-77136725 ATCTGTCACCAGAGCATGGATGG - Intronic
1121455852 14:94038551-94038573 ATGTGTGAGCAGGGGCGGGAGGG - Intronic
1122509480 14:102254897-102254919 ATGTGTGGACATGGCTGGGAAGG - Intronic
1122541554 14:102500444-102500466 GTGTGTGAGCAGGCGTTGGAGGG + Exonic
1122811333 14:104290891-104290913 GTGTGCCACCAGGGCTTGGCAGG + Intergenic
1124152699 15:27196171-27196193 ATGTATAAGCAGGGCTAGGATGG - Intronic
1130232039 15:82104536-82104558 ATGTGGGCCCAGGGGTTGTAGGG - Intergenic
1131035126 15:89217099-89217121 AGGTGAGGCCAGTGCTTGGAGGG - Exonic
1131284139 15:91043634-91043656 GTGTGTGAGCAGGGCTGGGGAGG - Intergenic
1133438880 16:5803980-5804002 ATCTCTGAGCTGGGCTTGGAAGG - Intergenic
1133487187 16:6231694-6231716 ATGTCTGCCCTGGACTTGGAAGG + Intronic
1133706776 16:8362238-8362260 TTGTGTGTGCAGGGCTGGGAAGG - Intergenic
1133876706 16:9741570-9741592 TTCTATGGCCAGGGCTTGGATGG + Intergenic
1135112819 16:19704008-19704030 ACCAGTCACCAGGGCTTGGATGG + Exonic
1136073344 16:27802134-27802156 CTGTGTGGCCAGAGCTTGAAAGG - Intronic
1136654882 16:31703710-31703732 ATCTGTCACCGGGGCCTGGAGGG + Intergenic
1137429034 16:48403515-48403537 TTTTGTGACCAGGGCTGGGCAGG + Intronic
1137523255 16:49211621-49211643 ATGTGTGACAAGGGCCCAGATGG - Intergenic
1138550257 16:57743942-57743964 ATGTGTGCCCAGGACTAGGCAGG + Intronic
1139962354 16:70725276-70725298 ATGTGGGAGCTGGGCTTGGGAGG + Intronic
1144769389 17:17751149-17751171 GTGTGTGGCCAGTGCTAGGATGG + Intronic
1146958698 17:36953772-36953794 CTGTGGGACCAGCTCTTGGAAGG + Exonic
1147378253 17:40035832-40035854 ATGTGAGACCTGGGGGTGGATGG - Intronic
1147493701 17:40895760-40895782 AGGTGTGATCTGGGCTTGGATGG + Intergenic
1148192463 17:45689088-45689110 ATGTGTGGCCAGGCCTGGCAGGG + Intergenic
1148653281 17:49264995-49265017 ATGTGTGAGCTGGGTTTTGAAGG + Intergenic
1151655352 17:75493248-75493270 ATTGGGGACCAGGGCTGGGATGG + Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1155198977 18:23501238-23501260 ATGTGTGACATGGGCCTGGGTGG + Intergenic
1155279981 18:24229512-24229534 TGGTGTGACCAAGGCTTTGAAGG - Intronic
1155357059 18:24963081-24963103 TTGTGTGCCCAGAGCCTGGAAGG + Intergenic
1156307143 18:35887808-35887830 CTGTGTGGCCAGGCCTTGGGTGG + Intergenic
1156485927 18:37465601-37465623 CTGTGTGCCCAGAGCTGGGATGG + Intronic
1156732647 18:40213118-40213140 GTGTGTTGCCAGGGCTAGGATGG - Intergenic
1157230622 18:45912367-45912389 AGGTGTGACCAGAGCCTGGTGGG + Exonic
1157315337 18:46582887-46582909 ATGAATGATCAGGGCTTGTATGG + Intronic
1160296784 18:77645718-77645740 ATGTGTGAACACAGTTTGGAAGG + Intergenic
1161038435 19:2097777-2097799 ATGTGTGTCCATGGCCCGGAGGG - Intronic
1163648971 19:18506098-18506120 ATGGGCACCCAGGGCTTGGAGGG - Intronic
1164078748 19:21844605-21844627 ATATGTGACAAGGGCCGGGAAGG + Intronic
1164810003 19:31148151-31148173 ATGTGTGCACAGTACTTGGAGGG - Intergenic
1165393507 19:35551399-35551421 AGTTGGGACCAGGGGTTGGAGGG + Intronic
1166193844 19:41193654-41193676 GTGGGGGACCAGGGCTAGGAGGG + Intronic
1167757424 19:51421487-51421509 CTGTCTGACCAAGGCTGGGAGGG - Intergenic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
925999971 2:9322848-9322870 AAGTCTGCACAGGGCTTGGAGGG - Intronic
926364277 2:12118749-12118771 ATGTCTGACCAGGGTTGGTATGG + Intergenic
926968707 2:18444531-18444553 TTGTGTCACCATGGTTTGGAGGG + Intergenic
927417526 2:22894224-22894246 ATGTGTCACCATGGATGGGAAGG - Intergenic
927431178 2:23027537-23027559 GTGTGTGGCCAGGGTGTGGAAGG - Intergenic
928891012 2:36203007-36203029 ATGTTTGAGCAGGGATTTGAAGG - Intergenic
931578225 2:63743069-63743091 ATGAGTAAACAAGGCTTGGAGGG + Intronic
932229131 2:70068080-70068102 ATTGGTGACCAGGGCTTGCCTGG - Intergenic
932421112 2:71601975-71601997 ATGTGTGAGAAGGCCCTGGAGGG - Intronic
935954165 2:108358668-108358690 TTCTGTGACCAGGGATTGAAGGG + Intergenic
936351323 2:111714784-111714806 AGGTGAGAGCAGGGCTTGCATGG + Intergenic
937073568 2:119084137-119084159 GTCTGTGACCAGGGCTGGGTTGG + Intergenic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
939957243 2:148537368-148537390 GTGCCTGGCCAGGGCTTGGATGG + Intergenic
940366456 2:152853434-152853456 ATGTGTGATGAGGGTTGGGAGGG - Intergenic
941501445 2:166283351-166283373 ATGTGTGGCCATGGATTTGATGG + Intronic
943009962 2:182435346-182435368 ATGGCTGAACAGGGGTTGGAAGG + Intronic
946305289 2:218853461-218853483 GAGTGTGAACAGGGCGTGGAGGG + Intergenic
946484174 2:220084989-220085011 ATGTGCAATCAGGGCTTAGAAGG - Intergenic
948006155 2:234609500-234609522 ATATGTGCCTGGGGCTTGGAAGG - Intergenic
948264793 2:236628618-236628640 TTGTGGGACCAGGGCCTGGTAGG - Intergenic
948675194 2:239592922-239592944 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675213 2:239593001-239593023 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675231 2:239593080-239593102 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675250 2:239593159-239593181 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675268 2:239593238-239593260 ATGTGTAATCGGGGCATGGATGG + Intergenic
948675305 2:239593396-239593418 ATGTGTAATCGGGGCATGGATGG + Intergenic
1169085000 20:2821041-2821063 GTCTGTGACCACGGCTTCGATGG - Intergenic
1170159057 20:13294301-13294323 ATGTGTGTGAAGGGATTGGAGGG - Intronic
1170870933 20:20205674-20205696 CTGTCTGACCTGGGCTAGGAAGG + Intronic
1171402129 20:24880595-24880617 ATTTGTGAACAAGGCTTGGCTGG - Intergenic
1172445004 20:34988323-34988345 ATGGATGACCATGGCTTGCATGG + Intronic
1173172877 20:40741748-40741770 CTGTGTGGCCAGTGCTTGTAGGG + Intergenic
1173234725 20:41234327-41234349 ATGTGTGATTAGGGTTTGAAAGG + Intronic
1173326513 20:42038460-42038482 GTGTCTGAGCAGGGCCTGGAAGG + Intergenic
1174209314 20:48864903-48864925 ATGTGTCACCAGGGATTTAATGG - Intergenic
1175272532 20:57744755-57744777 ATGTGTGTCCTGAGCTTGGCAGG - Intergenic
1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG + Exonic
1179185995 21:39085725-39085747 AGGGGTGGCAAGGGCTTGGAGGG - Intergenic
1180460235 22:15556362-15556384 ATGTGTAAGCAGGTCTTGGTGGG + Intergenic
1180971059 22:19815974-19815996 CTGTGTGCACAGGGCTAGGAGGG - Intronic
1181052299 22:20243616-20243638 AAGTGTGTCCAGGGCTTAGGAGG + Intronic
1183452174 22:37902722-37902744 ATGTGTGAACAAGGTGTGGAAGG + Intergenic
1183578739 22:38709619-38709641 ATCTGTAAACAGGGCCTGGAAGG - Intronic
949929736 3:9069354-9069376 CAGTGTGCCCAGGGCTGGGAAGG + Intronic
956090633 3:65662958-65662980 AGTTGTGAGCAGGGCATGGATGG + Intronic
959438598 3:106348831-106348853 ATGTATGATAAGGGCTTTGATGG + Intergenic
960509934 3:118537072-118537094 ATGTTAGTCCAGGGTTTGGACGG - Intergenic
960518936 3:118632614-118632636 AAATTTGAGCAGGGCTTGGAAGG - Intergenic
961554154 3:127686302-127686324 ATGTGTGATGAGGGAATGGATGG - Intergenic
961554234 3:127687066-127687088 ATGTGTGATGAGGGAATGGATGG - Intergenic
964197893 3:154085644-154085666 AAATGTGACCAGGACTGGGAAGG - Intergenic
967269458 3:187720766-187720788 ATGTGTCAGCAGAGCTAGGAGGG + Intronic
968631040 4:1651687-1651709 CTGGGTGACCAGCGCTTGCATGG + Intronic
968870210 4:3238327-3238349 ATGTGAAATCAGGGCTGGGAGGG - Intronic
969440376 4:7213353-7213375 CTTTGTGTCCAGGGCATGGAGGG + Intronic
970383454 4:15531649-15531671 ATTTGTGACCAGAGCTGGGGAGG - Intronic
970782002 4:19748766-19748788 ATGTGTGGCCAGGAAATGGAGGG - Intergenic
972121459 4:35709733-35709755 ATGTGACACCAGTGATTGGAGGG - Intergenic
973921412 4:55689408-55689430 ATGTGTTACCAGGCTATGGATGG - Intergenic
979363611 4:119794180-119794202 ATGTGTGACCAGGTTTGGGGTGG - Intergenic
981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG + Intronic
983672448 4:170254123-170254145 ATGTAGGACCAGGGGTTGGGAGG + Intergenic
983744900 4:171186053-171186075 TTTTGTGAACAGGGCTTGGAAGG + Intergenic
986354225 5:6908068-6908090 ATATGAGCCCAGGGCTTGGCAGG - Intergenic
986737189 5:10676447-10676469 AGGTGAGACCACTGCTTGGAGGG - Intergenic
987040835 5:14060852-14060874 TGGTTTGACCAGGGCTAGGATGG + Intergenic
987072859 5:14354153-14354175 CTGTCTGAGCAGGGCTGGGAGGG + Intronic
988491784 5:31711333-31711355 ATGTGTGACAGGGGATGGGAAGG + Intronic
991388297 5:66114564-66114586 AAGTGTTACCAGGGCCTGGGGGG + Intergenic
991420574 5:66437214-66437236 ATTTGTGACAAGGAATTGGAAGG - Intergenic
994051779 5:95370057-95370079 GTTTGTGACCAAGACTTGGAGGG - Intergenic
994164213 5:96592058-96592080 GTGTTTGACCAGTGCTTTGAAGG + Intronic
998527947 5:142859728-142859750 ATGTGTGAGGAGGGCCTGAAAGG + Intronic
998968712 5:147568335-147568357 ATGAGGGACCAAGGCTTGAATGG + Intergenic
1000763003 5:165250093-165250115 TTGTGTGTTCAGGGCCTGGAGGG - Intergenic
1001802032 5:174552720-174552742 ATGGTTGAGCAGGGCATGGAGGG - Intergenic
1004042001 6:11988510-11988532 CTGAGTGACCTGGCCTTGGAGGG + Intergenic
1005003108 6:21262694-21262716 ATGTGTGAGCAGGGTTTTGAAGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006360678 6:33585433-33585455 ATATGTGGCCTGGGCCTGGAAGG + Intergenic
1007656308 6:43453115-43453137 AGGTGTGACCCGGGCTGGGAGGG - Exonic
1011722755 6:90176148-90176170 AAATGAGAACAGGGCTTGGAAGG - Intronic
1012261615 6:97093955-97093977 ATTTGAGACCAGAGATTGGATGG + Intronic
1013653653 6:112223137-112223159 TTGTGTAACCATAGCTTGGAAGG - Intronic
1014265072 6:119268348-119268370 ATGTGTGACCAGGGCGTTACAGG - Intronic
1014795282 6:125717715-125717737 AAGTTTTACCTGGGCTTGGATGG - Intergenic
1015626646 6:135185940-135185962 ATGTGTGACCATGACTATGATGG + Exonic
1016667273 6:146656876-146656898 ATGTGTTCCCAGGGCTTCCAGGG - Exonic
1017058047 6:150455514-150455536 ACCTGTGACCAGGGCACGGAGGG + Intergenic
1018182121 6:161233057-161233079 GTGTGTGACCAGGGTGTGGTGGG - Intronic
1018382261 6:163269216-163269238 ATGTGTTACCAGGTGCTGGATGG - Intronic
1019519679 7:1455008-1455030 ATTTGTGGCCAGGCCTTGGGAGG - Intronic
1020693111 7:11382572-11382594 ATGGATGGCCAGTGCTTGGAAGG - Exonic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1025078071 7:55960436-55960458 ATGTGTCACCAGCTCTGGGATGG + Intronic
1027230194 7:76267886-76267908 AGGTGGGGCCAGGGCTTGGTGGG - Intronic
1027516474 7:79148092-79148114 ATGTGGGAGCTGGGCTTCGATGG - Intronic
1029860077 7:103561689-103561711 AGGTGTGACCGGGGCTTTGGTGG - Exonic
1030271634 7:107675027-107675049 CTGTGAGACCAGCACTTGGAAGG - Exonic
1034948477 7:155280055-155280077 ATGAGTGACCAGGTCGTGGAGGG - Intergenic
1037495499 8:19436826-19436848 ATGTGAGCCCAGGAGTTGGAGGG + Intronic
1037680631 8:21094574-21094596 ATATGTGCCCAGTGCTTGGAGGG - Intergenic
1037828119 8:22171952-22171974 ATGTGTGTCCCTGGCTTTGATGG + Intronic
1038272605 8:26087737-26087759 ATGTATGACCTGGGGTTGGAGGG + Intergenic
1039440019 8:37588567-37588589 ATAGGTGACCATGGCTTGGATGG + Intergenic
1039557162 8:38484779-38484801 AAGTGTGGCCTGGGCTGGGAGGG + Intergenic
1040619786 8:49078667-49078689 ATCTGTGATCAGTGCTGGGAAGG - Intergenic
1043157406 8:76800911-76800933 ATGTCTCACCAAGGCTTAGAAGG - Intronic
1043462801 8:80477854-80477876 AATTGTGACAAGGGCTGGGAGGG + Intergenic
1045320250 8:101077059-101077081 ATGTCTCAGCAGGGCCTGGAAGG + Intergenic
1046274898 8:111945825-111945847 ATGTTTAACCAGAGATTGGAAGG + Intergenic
1048878890 8:138857384-138857406 GTGTTTGGCCAGGGCATGGAAGG - Intronic
1049574596 8:143384436-143384458 ATGTGTGGGCAGGGGTGGGACGG - Intergenic
1050684747 9:8155383-8155405 ATATCTGAACAGGGCTTGGAAGG - Intergenic
1057256883 9:93556880-93556902 ATATGTGACCAGAGCCTTGAAGG - Intronic
1059238722 9:112784777-112784799 AGGTTTGACCTGGGCTTGGCAGG - Intronic
1060119431 9:120974301-120974323 ATGTATGACCAGGGCCAGAAGGG + Intronic
1062215364 9:135386167-135386189 AGGTGAGACCAGGGTTTGGTGGG + Intergenic
1062459638 9:136657514-136657536 GTGTCAGACCAGGGCATGGAGGG - Intergenic
1062490729 9:136803718-136803740 AGGTGTGGCCAGGGCTAGGGAGG + Intronic
1189196697 X:39159600-39159622 AAGTGTGGGCAGGGCTCGGAAGG + Intergenic
1190872594 X:54437063-54437085 ATGGTTGCCCAGGGCTTGGATGG - Intergenic
1191108062 X:56784406-56784428 ATCTGTGCCCAGGGGTGGGAGGG + Intergenic
1192012426 X:67289228-67289250 ATTTGTGACCTGGGCTGGGAGGG + Intergenic
1196785680 X:119419610-119419632 ATGTGGGACCATGGCTCAGAAGG - Intronic
1197895248 X:131306128-131306150 ATGTGTGACCAGGGGGGGTAAGG - Intronic
1199743375 X:150756550-150756572 ATGGGTGGCCAGGGCATGGTTGG + Intronic
1199952038 X:152714867-152714889 TTGTGTGACCAGGGCAGGGCTGG + Intronic
1199954677 X:152734044-152734066 TTGTGTGACCAGGGCAGGGCTGG + Intronic
1199957645 X:152753581-152753603 TTGTGTGACCAGGGCAGGGCTGG - Intronic