ID: 981049055

View in Genome Browser
Species Human (GRCh38)
Location 4:140293171-140293193
Sequence AACATTCTGTTGGGGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981049055_981049060 4 Left 981049055 4:140293171-140293193 CCATTCTCCCCCAACAGAATGTT 0: 1
1: 1
2: 0
3: 25
4: 266
Right 981049060 4:140293198-140293220 CACATGAAATCTTAAACAACTGG 0: 1
1: 1
2: 0
3: 13
4: 211
981049055_981049063 23 Left 981049055 4:140293171-140293193 CCATTCTCCCCCAACAGAATGTT 0: 1
1: 1
2: 0
3: 25
4: 266
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049055_981049064 24 Left 981049055 4:140293171-140293193 CCATTCTCCCCCAACAGAATGTT 0: 1
1: 1
2: 0
3: 25
4: 266
Right 981049064 4:140293218-140293240 TGGGCTGCCACTAGGTGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 181
981049055_981049061 5 Left 981049055 4:140293171-140293193 CCATTCTCCCCCAACAGAATGTT 0: 1
1: 1
2: 0
3: 25
4: 266
Right 981049061 4:140293199-140293221 ACATGAAATCTTAAACAACTGGG 0: 1
1: 0
2: 2
3: 15
4: 283
981049055_981049062 16 Left 981049055 4:140293171-140293193 CCATTCTCCCCCAACAGAATGTT 0: 1
1: 1
2: 0
3: 25
4: 266
Right 981049062 4:140293210-140293232 TAAACAACTGGGCTGCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981049055 Original CRISPR AACATTCTGTTGGGGGAGAA TGG (reversed) Intronic
901006869 1:6176142-6176164 AACATTCTTTTCTGGGAGGAGGG - Intronic
901155226 1:7132281-7132303 AAGACTCTGTTGAAGGAGAAGGG - Intronic
901265926 1:7910693-7910715 AATATTCTGTTGGGGGCCAGTGG - Intergenic
903429799 1:23286632-23286654 AGCATGCTGTTGGGGGAAAATGG - Intergenic
903472619 1:23597986-23598008 TACATTCTGGTGGGAGAGACAGG + Intronic
905089497 1:35417382-35417404 AAAATACTGTTGGGGAAAAATGG + Intronic
905602245 1:39263247-39263269 AATATTCAGTTGAAGGAGAAGGG + Intronic
906028148 1:42693028-42693050 TACATTCTGTTGGTGGGGAGGGG + Intronic
906625191 1:47319317-47319339 AGTATTGGGTTGGGGGAGAAAGG + Intergenic
910479939 1:87647459-87647481 AATATTCTTTTGCGAGAGAAGGG - Intergenic
911253685 1:95609548-95609570 AATATTATGGTGGGGGAGAAAGG + Intergenic
911366441 1:96944709-96944731 AATGTTCTTGTGGGGGAGAAGGG + Intergenic
915288943 1:154870053-154870075 AAGATACTGGTGGGGGAGATTGG - Exonic
916378175 1:164178895-164178917 AACATGCCTTTGGGGGAAAAAGG - Intergenic
916617026 1:166452403-166452425 AAAATTCTGTGTGGGAAGAAGGG + Intergenic
917623904 1:176826509-176826531 ACCAACCAGTTGGGGGAGAAAGG + Intronic
919171970 1:193966134-193966156 TGAATTCTGTTGGGGAAGAATGG - Intergenic
919443385 1:197668367-197668389 AACATTCTGGTGGGAAAGAAGGG + Intronic
919443406 1:197668587-197668609 AACATGCTGGTGGGAGAGAAGGG - Intronic
920903092 1:210132078-210132100 AACCTTCTGCAGGGTGAGAAGGG - Intronic
921754164 1:218834224-218834246 AATGTTCTGTTGGTGGACAACGG + Intergenic
922904793 1:229165868-229165890 ACCATTCTGTTGGGTTAAAAAGG + Intergenic
923609476 1:235477171-235477193 AAAATTGGGTTGGGGGAGAGGGG - Intronic
1065749988 10:28876991-28877013 AAAATTCAGTTGTGAGAGAAGGG + Intronic
1067844607 10:49709853-49709875 ACCGTTCTGCTGGGAGAGAAGGG - Exonic
1067907953 10:50313782-50313804 AACAATGTGTTTGGGCAGAAAGG + Intronic
1068253141 10:54470114-54470136 AACATTCTGTTGGGGGTTTGGGG - Intronic
1068788008 10:60998406-60998428 TACATTCTGATGGGGAAGTAAGG + Intronic
1069688254 10:70333245-70333267 TACAGTGTGTTGGGGGAGGAGGG - Intronic
1070308683 10:75257051-75257073 GAAATTCTTTTGGGGGAGCATGG - Intergenic
1072092972 10:92147602-92147624 CACAGTCTGGTGGGGGAGACAGG + Intronic
1072591896 10:96833673-96833695 AATATTCCCCTGGGGGAGAAGGG - Intronic
1073541132 10:104316785-104316807 GACATTCACTTGGGAGAGAAGGG - Intronic
1075183254 10:120231527-120231549 TACATTCTATTTGGGGAGACAGG + Intergenic
1076318406 10:129560123-129560145 ATCATTCTGATGGGAGAGCACGG + Intronic
1078832877 11:14993188-14993210 AATATCCAGTTGGGGGAGAGGGG + Intronic
1079097753 11:17521779-17521801 AACTCTGTGTTGGGGGAGATGGG + Intronic
1081800894 11:45858682-45858704 AACACTGTGTTTGGGGAGGAGGG - Intronic
1081919709 11:46762188-46762210 GGCACTCTGATGGGGGAGAAAGG + Exonic
1083523371 11:63337394-63337416 AATATTCTGTGGGGGGTGCATGG + Intronic
1083970786 11:66073199-66073221 AACACTCTGTGGGGAGAAAATGG + Intronic
1086110961 11:83197500-83197522 AACATTCTGATTGTGGAGAGAGG + Intronic
1086211239 11:84322009-84322031 TACTTTCTGTTTGGGGAAAAGGG - Intronic
1086745152 11:90416320-90416342 AACATACTGTTGTGGGAGTCAGG + Intergenic
1088946777 11:114521838-114521860 AAGAATCTGTTTGGGGAGGAAGG - Exonic
1089276245 11:117337957-117337979 AGAATTCTGATGGGGGAGAAAGG - Intronic
1091010210 11:131994281-131994303 AACATTCTGAGGGGTGGGAAGGG + Intronic
1091175739 11:133556027-133556049 CACAGTCTGTTGGTGAAGAATGG - Intergenic
1091770256 12:3146808-3146830 GACATTCTCTGGGAGGAGAATGG + Intronic
1092241797 12:6840258-6840280 CTGATCCTGTTGGGGGAGAAAGG - Exonic
1092483701 12:8883218-8883240 TACACTCTGATGGGGGAGATGGG - Intronic
1093436545 12:19141166-19141188 AGCTTTCTGTTGGGGGGGAGGGG - Intronic
1093936371 12:25005408-25005430 AACTTTCTATTGTGAGAGAAAGG + Intergenic
1095403141 12:41838483-41838505 AACAGTCAGATGGGGGAAAATGG - Intergenic
1095826326 12:46533621-46533643 GGGATTTTGTTGGGGGAGAAAGG - Intergenic
1096447128 12:51703591-51703613 AACATTCTGTTGGGCTACACTGG + Intronic
1096766738 12:53897140-53897162 AACAATGTGCTGGGGGTGAAGGG + Intergenic
1096991090 12:55804018-55804040 AATATTCTGAGGGGGGAAAAAGG + Intronic
1099373520 12:81867298-81867320 AACATACTGTTGAGGGAAAAAGG + Intergenic
1099650995 12:85428111-85428133 GACATTCTGTTTGGTTAGAATGG - Intergenic
1100293902 12:93242923-93242945 AGCATTCCCTTTGGGGAGAAGGG - Intergenic
1100778723 12:98001028-98001050 AACATTTGCTGGGGGGAGAATGG - Intergenic
1101553642 12:105786260-105786282 AACATGCAGATGGAGGAGAATGG - Intergenic
1103646730 12:122399590-122399612 AAAATTCTGTTGGGAGGCAAAGG + Intronic
1104437954 12:128770932-128770954 AACATTCTGGTGCTGGAGAGAGG + Intergenic
1106037292 13:26055112-26055134 AGCAGTCTGTTTAGGGAGAATGG + Intergenic
1106202026 13:27546345-27546367 AAAATTCTATTTGGGGAGCAGGG + Exonic
1106953604 13:34911599-34911621 AAAATACTGATGGAGGAGAAGGG - Intergenic
1107657055 13:42602285-42602307 AACATTCTTGTGTGGAAGAACGG + Intronic
1107665246 13:42681639-42681661 AACATACTGTGGAGGGAGAGTGG - Intergenic
1107665778 13:42689000-42689022 AACAATCTGGTGAGGGAGCAGGG - Intergenic
1107706020 13:43106035-43106057 AACATGGTGTTGTGGTAGAAGGG - Intronic
1112778375 13:102870285-102870307 TGGATTCTGTTGGGGGAAAAAGG + Intronic
1115528100 14:34301453-34301475 AACATTGGGATGGTGGAGAAGGG + Intronic
1115627655 14:35210305-35210327 ACCATTTTGTTAGTGGAGAAAGG - Intronic
1116315566 14:43387006-43387028 ACCATTCTGGTGGGGGATAATGG + Intergenic
1117687117 14:58265088-58265110 AACATTTTGTTTTGGGAGATAGG - Intronic
1117816764 14:59606808-59606830 AACCTTCTGGTGGGGGTGCAGGG - Intronic
1118218921 14:63836744-63836766 CACAGACTGTCGGGGGAGAAAGG - Intergenic
1118419715 14:65588309-65588331 AAAAGTCTGTTGGGGGATGAAGG - Intronic
1119551868 14:75520788-75520810 AACATTCTATTGAGGGAAACAGG + Intergenic
1119829362 14:77687322-77687344 AACATTCTATTAATGGAGAAAGG - Intronic
1120037820 14:79717902-79717924 AACATTTTTTTGGGAGAGCAGGG + Intronic
1121153328 14:91658398-91658420 GGCATTATGTAGGGGGAGAATGG + Intronic
1121220421 14:92280788-92280810 TACATTCTAGTGGGGGAGAGAGG + Intergenic
1121917020 14:97844578-97844600 TACAGTCTGGTGGGGGAGACAGG - Intergenic
1123916115 15:25029123-25029145 AAAAATTTCTTGGGGGAGAATGG + Intergenic
1125930670 15:43597735-43597757 AACATTCTGTTAGCTGTGAACGG - Intronic
1128113870 15:65093504-65093526 AACTTTCTGCTGGGGCAGGAGGG + Intronic
1128850349 15:70948642-70948664 AACATCTTGTTGGGCCAGAAAGG - Intronic
1129260984 15:74367225-74367247 AACAGCCTGTTGGGGGAGTGGGG + Intronic
1129690584 15:77711068-77711090 GACATTCTGGAGGGGAAGAAGGG - Intronic
1129980115 15:79861316-79861338 CACATTTTGTTGGGGAAGACAGG - Intronic
1130056719 15:80532616-80532638 AGCATGCTGTTGGGAGAGAGAGG + Intronic
1130093928 15:80842295-80842317 AAGGTCCTGGTGGGGGAGAAAGG - Intronic
1130680104 15:85989195-85989217 AACCTTCATTTTGGGGAGAACGG + Intergenic
1131760343 15:95616032-95616054 AAGATTTGGCTGGGGGAGAAGGG + Intergenic
1131879881 15:96851362-96851384 ATCATTCTGGTGGCGGAGGATGG + Intergenic
1132781710 16:1630110-1630132 AACATGCTGATGGGGGGTAAGGG - Intronic
1132943117 16:2518305-2518327 AACATTCTCTTGGGAGAGGAAGG + Intronic
1133517853 16:6527359-6527381 ATCACTTTGTTGGGGGAGGAAGG - Intronic
1133857195 16:9560634-9560656 AACAAACTGTAGGGGGACAAAGG + Intergenic
1134516445 16:14891135-14891157 AATACTCTGTTGGGGAAAAAAGG - Intronic
1134704118 16:16289787-16289809 AATACTCTGTTGGGGAAAAAAGG - Intronic
1134963425 16:18422327-18422349 AATACTCTGTTGGGGAAAAAAGG + Intronic
1134967720 16:18504926-18504948 AATACTCTGTTGGGGAAAAAAGG + Intronic
1135709253 16:24701058-24701080 AACATTCAGTTCTGGGAGGAAGG + Intergenic
1137273984 16:46921466-46921488 AACATGCTTTTGGGGGAGCCGGG - Intronic
1139089457 16:63627474-63627496 AACATTCTTTTGGGGGTAAAGGG - Intergenic
1139153808 16:64416506-64416528 AACAGTCTAGTGGGGAAGAATGG - Intergenic
1140234367 16:73145187-73145209 AGCCTCCTGTTGGGGGAGCAGGG + Intergenic
1141648541 16:85380064-85380086 AACATTCTGATGGGCTAAAAGGG + Intergenic
1143649251 17:8253213-8253235 TATATTTTATTGGGGGAGAAAGG - Intronic
1143986221 17:10916734-10916756 AACATTCTGATGGGGGACTTTGG + Intergenic
1146208635 17:30924764-30924786 TACATTCTAGTGTGGGAGAAAGG + Intronic
1146508714 17:33427560-33427582 AGCATTTTATTGGGGGAGGATGG - Intronic
1146807446 17:35876279-35876301 GACATTCTTTTGTGGGAAAAAGG - Intronic
1148135798 17:45290827-45290849 AGCCTTGGGTTGGGGGAGAAAGG + Intronic
1148346827 17:46908782-46908804 AGCTTTCTGTTGGAGGTGAATGG - Intergenic
1148944121 17:51243857-51243879 AGCATTCTGTTAAGGGGGAAGGG - Intronic
1155363341 18:25025836-25025858 CACATGCTGTTGGTGGGGAAAGG - Intergenic
1156318286 18:35992653-35992675 GATATTTTGTTTGGGGAGAAGGG + Exonic
1157141818 18:45115944-45115966 AGCATTCTCATGGGGAAGAAAGG - Intergenic
1158622962 18:59048443-59048465 AAAATCCTGTGGGGGAAGAATGG + Intergenic
1158644517 18:59232723-59232745 AAAATTCTTTTTGGGGAAAAAGG - Intergenic
1159385477 18:67719542-67719564 TACATTTTCTTGGGGAAGAAAGG + Intergenic
1160251214 18:77204886-77204908 AACATGAGGTTGGGGGGGAAGGG - Intergenic
1162667048 19:12222576-12222598 AACATTTTTTGGGGGGAGACAGG + Intergenic
1162924344 19:13922629-13922651 GACATTCTCTTGGGGGAGATGGG - Intronic
1164456655 19:28413208-28413230 TACAATCTGATGGGGGAGATGGG - Intergenic
1165369243 19:35392671-35392693 TACAGACTGTTGGGGAAGAAAGG - Intergenic
1165899336 19:39161563-39161585 AACAGTCTGTGGGGGCAGAACGG - Intronic
926010683 2:9404231-9404253 AACATTCTCCTGGGCTAGAAGGG - Exonic
926472337 2:13276423-13276445 TAAATGCTATTGGGGGAGAAAGG + Intergenic
927701941 2:25274686-25274708 GACATTCTGATGGGGGAGACAGG - Intronic
928050530 2:27989705-27989727 AAAATTCAGTGGAGGGAGAAAGG + Intronic
929171720 2:38938851-38938873 AACATTATGTTGGGAGAAAGAGG - Intronic
933111741 2:78409110-78409132 AACTTTCTGTTGTGGGCAAAAGG - Intergenic
935633435 2:105231383-105231405 AACCTGCTGTTAGGGAAGAATGG + Intergenic
935720949 2:105978790-105978812 AAGATTTTGCTGGGGGAGCAAGG + Intergenic
936861548 2:117026340-117026362 CTCCTGCTGTTGGGGGAGAAAGG + Intergenic
937529095 2:122807294-122807316 GACATTCCGTTGTGGGAGCACGG + Intergenic
938696932 2:133843006-133843028 CACATTCTGTTGGGCAATAATGG - Intergenic
938743264 2:134252804-134252826 AACAGGCTGTTGGGGGAGTGAGG + Intronic
939436089 2:142180170-142180192 AACAGTTTGTTTGGGGAAAAAGG - Intergenic
940002989 2:148985425-148985447 CACATACTTTTGGGGGAGATGGG - Intronic
940574849 2:155489748-155489770 AACATTCTAGTAGGGGAAAAAGG + Intergenic
942208907 2:173650964-173650986 AAAATATTGTTGGAGGAGAAGGG - Intergenic
943409359 2:187527158-187527180 AAAACTATGTTGGAGGAGAAGGG + Intronic
943702425 2:191001017-191001039 AACTTTCTGTAGGGGAAAAAAGG - Intronic
946289498 2:218733339-218733361 AACATTCAGTTGTGGCGGAAGGG + Intronic
946331196 2:219010080-219010102 GACATTCTGTGGGTGGAGAGCGG + Exonic
946960247 2:224977404-224977426 AACATTCTCTTTCGGGGGAAGGG + Intronic
1169774015 20:9232019-9232041 AACATTCTGCTGGGTGAAAGAGG + Intronic
1169828151 20:9792045-9792067 TACAGTCTGGTAGGGGAGAAAGG - Intronic
1171158522 20:22899347-22899369 AACATTTGCTTGGGGGAGGACGG - Intergenic
1172005315 20:31815606-31815628 AAGAATGTGTTGGGGGTGAAGGG - Intergenic
1172389558 20:34557931-34557953 AACATTTTTTTGGGGGAGGGGGG - Intronic
1174505299 20:51013873-51013895 GACATTCTGTTTGGCAAGAATGG + Intronic
1174651344 20:52128402-52128424 AATATTCTGTAGCTGGAGAAAGG + Intronic
1175104771 20:56606949-56606971 AACATTTTTTTGGCGGAGGAGGG + Intergenic
1175749842 20:61488021-61488043 ATGATTCTGTGGGAGGAGAAGGG + Intronic
1175773661 20:61639592-61639614 AACATTATTGTGGGGCAGAAGGG + Intronic
1179483665 21:41694672-41694694 AACATTCTGTTCCGGGATATAGG - Intergenic
1180687236 22:17679027-17679049 AACCTTCTGTTAGAGGAGAGTGG - Intronic
1181600901 22:23951414-23951436 AGCAGTCTGTGGAGGGAGAATGG + Intergenic
1181607612 22:23989912-23989934 AGCAGTCTGTGGAGGGAGAATGG - Intergenic
1182193890 22:28493981-28494003 AACACACTGTGGGGTGAGAATGG + Intronic
950670529 3:14522782-14522804 AGCAGTATGTTGGGGAAGAAAGG + Intronic
950737004 3:15017414-15017436 GACATTCTGATGGGGAAGACAGG - Intronic
952893051 3:38056935-38056957 ATCATTCTGATGGGTGTGAAAGG - Intronic
953536633 3:43782038-43782060 CACAGTCTGTTGGGGGACAATGG - Intergenic
955635498 3:61024314-61024336 GTTATTTTGTTGGGGGAGAAGGG - Intronic
955801487 3:62691375-62691397 ATCATTCTGTTGGGGGATGTTGG + Intronic
955804622 3:62721252-62721274 AAAAATCTCTTGTGGGAGAATGG - Intronic
956358534 3:68420365-68420387 AAAATTAGGTTGAGGGAGAATGG - Intronic
956580022 3:70800228-70800250 CACATTCTGTTGGGCTTGAAGGG - Intergenic
958071843 3:88624536-88624558 AACTTTCTGTTGAGAGAAAAAGG + Intergenic
958481519 3:94651050-94651072 AACAGTCTGTTGGGTGACAGAGG - Intergenic
958877336 3:99631331-99631353 AACAGTCTGGTAGGGGAGAGAGG - Intergenic
959773875 3:110134008-110134030 AATATTCAGCAGGGGGAGAAAGG - Intergenic
960221526 3:115116197-115116219 AACATCCTGATGGGAGAGAGTGG - Intronic
960244600 3:115386442-115386464 AACATTCAGATGGGGCACAATGG - Intergenic
963269782 3:143274474-143274496 GACTCTCTGTTGGGGAAGAAAGG + Intronic
964544879 3:157822828-157822850 TACATTCTGGTGGGGGAGATAGG - Intergenic
965273568 3:166650973-166650995 AACATTGTGTTGGGTAATAATGG + Intergenic
966327728 3:178775975-178775997 AAAATTCTGCAGGGTGAGAAGGG - Intronic
968853794 4:3103125-3103147 AACATTCTGTTGGATGATACGGG - Intronic
970279065 4:14434108-14434130 AACATTCTAGTGGCGGAGAAAGG - Intergenic
970359005 4:15288529-15288551 AACAAACTGTTGGGGGAGCCAGG + Intergenic
971003119 4:22344728-22344750 AACATTTTGATGAGGGAGAAAGG - Intergenic
971096739 4:23414342-23414364 ACCATTCTGTTGGGGGAGAAAGG - Intergenic
971539562 4:27798896-27798918 AACATTCTGTTGGGGCAATTCGG - Intergenic
972803045 4:42497418-42497440 AACAAACTTGTGGGGGAGAATGG + Intronic
973021744 4:45211324-45211346 AGCATTTTGTTGCTGGAGAAAGG + Intergenic
974204561 4:58684101-58684123 AACATTGTCGTGGTGGAGAAGGG - Intergenic
975168804 4:71209338-71209360 AACAGTCTACTGGGGGAGACAGG + Intronic
977401649 4:96540449-96540471 AACAATCTAATGGGGGAAAAAGG - Intergenic
978825407 4:113016633-113016655 AAACTTATGTTGGGGGAGATGGG - Intronic
979700968 4:123667448-123667470 AATATTCTTTTGGTGGAGACAGG + Intergenic
981025966 4:140077361-140077383 AAGATTTTGTTGGGTGAGGAGGG - Intronic
981049055 4:140293171-140293193 AACATTCTGTTGGGGGAGAATGG - Intronic
981655581 4:147108864-147108886 AACTATTTGTTGGGGGAGAAAGG + Intergenic
981775381 4:148361522-148361544 GACATAATGTTGGAGGAGAATGG - Intronic
982129524 4:152215254-152215276 AACAATTTGTTGGGGGAGGCGGG + Intergenic
982911512 4:161148459-161148481 ATCATTCTCTTTGAGGAGAAGGG + Intergenic
984578621 4:181482631-181482653 AACCTTTTTTTGAGGGAGAAAGG - Intergenic
985378582 4:189368420-189368442 AATCTTCTGTTGGGTGTGAATGG - Intergenic
986218127 5:5740205-5740227 AACAGTCTTTTGGGGTTGAAAGG - Intergenic
987203808 5:15604292-15604314 AACTTTTTATTGGTGGAGAAGGG - Intronic
987503761 5:18744919-18744941 AATATTCTTTTGAGGGAAAATGG - Intergenic
988271992 5:29028963-29028985 AACATTCTGAAGGTAGAGAATGG + Intergenic
988285517 5:29211199-29211221 GATATTCTGTGGGGGGATAATGG + Intergenic
989118420 5:37979023-37979045 TACATTCTGGTAGGGGAGACAGG + Intergenic
992320986 5:75612663-75612685 AACATTCTGTTGTGGTGGAGGGG + Intronic
992546232 5:77816647-77816669 ACCATTCTGGTGGGGGATATTGG + Intronic
992991429 5:82287611-82287633 AACATTTAGTTGGGGTAGAAAGG + Intronic
994104289 5:95929205-95929227 CACAGTCTGGTGGGAGAGAAAGG - Intronic
994640363 5:102400954-102400976 AACTTTCTATTTGGGGAGACAGG + Intronic
995248505 5:109962743-109962765 AAAAATCTGTGGGGGGAGAAAGG - Intergenic
995433490 5:112109148-112109170 AACAGTATGTTGGGGCAAAAGGG - Intergenic
995891895 5:116963263-116963285 CAATTTCTGTTTGGGGAGAAAGG - Intergenic
996445952 5:123550503-123550525 GGCATTCTGTAGGGGGAGAATGG + Intronic
998378600 5:141708159-141708181 GCTATTCTGTTGTGGGAGAAGGG - Intergenic
998970529 5:147586531-147586553 AAAGTTCTGTAGGGTGAGAATGG - Intronic
999162741 5:149518206-149518228 AATATTTTTTTGGGGGGGAAGGG - Intronic
999783876 5:154873865-154873887 CACAATCTGGTGGGGGAGAGTGG + Intronic
1000102680 5:158031794-158031816 AACAGTCTGTTGGGGGGTGAGGG - Intergenic
1000693114 5:164346943-164346965 CACAGTCTAGTGGGGGAGAAAGG + Intergenic
1001200653 5:169713188-169713210 CACATTCTGTCAGGGAAGAAGGG - Intronic
1001955182 5:175843930-175843952 AACACTGTGTAGGGGGTGAAAGG - Intronic
1002024416 5:176387330-176387352 AAGATTGTGTTGGGGGTAAAAGG - Intronic
1002866198 6:1124464-1124486 TCCATTGTGTTGGGTGAGAAAGG + Intergenic
1004033786 6:11901303-11901325 AACATGCTGTTAGGGCAGACTGG + Intergenic
1005897511 6:30190714-30190736 AAAATTCAGTTGGGGTAAAAAGG - Intronic
1007246698 6:40468435-40468457 ATCATTCCTTTGGGGAAGAAGGG + Intronic
1008168091 6:48165951-48165973 GACATGCTGTAGAGGGAGAAAGG - Intergenic
1012034522 6:94115868-94115890 AACATATTGTTTGGGGAAAATGG - Intergenic
1013457842 6:110347673-110347695 AACATTCTTTTGAGGGAAAATGG + Intronic
1013996215 6:116311285-116311307 TATATTCTGGTGGGAGAGAAAGG - Intronic
1014960185 6:127673508-127673530 AAGAGACTGTTGGAGGAGAATGG + Intergenic
1016772017 6:147862240-147862262 AACATACTCTCGAGGGAGAAAGG - Intergenic
1018076828 6:160224117-160224139 CACACTATGTTGGGGAAGAATGG - Intronic
1018376465 6:163218006-163218028 AAAATTGTGTTGGGTGAGACTGG + Intronic
1018690181 6:166338410-166338432 TACATTCAGATGGGGGAAAATGG + Intronic
1020376829 7:7496903-7496925 AACATTTTGTAGGTGCAGAATGG + Intronic
1024324420 7:48097728-48097750 AACATCCTGAAGGAGGAGAATGG + Intronic
1024583914 7:50824393-50824415 TACATTCTAGTGGAGGAGAAAGG - Intergenic
1026267554 7:68808643-68808665 AACATTCTCTTAGGGGAAAAAGG + Intergenic
1026544185 7:71307470-71307492 CACAATCTGTTGGAGGAGACGGG + Intronic
1027978877 7:85191440-85191462 AACATGCTGTAAGGGTAGAATGG - Intergenic
1028697244 7:93728815-93728837 AAGGTTCTGTTTGGGGATAAGGG - Intronic
1028837952 7:95395942-95395964 AACATTCTGCTTGGGAAAAAAGG - Intronic
1028901290 7:96103072-96103094 AAAATCCTGTTGGGTGACAATGG - Intronic
1032149730 7:129418033-129418055 AGCATTCTGTTCAGAGAGAATGG + Intronic
1032528308 7:132597257-132597279 AACAAACTATTGGGGGAGACCGG - Intronic
1033241457 7:139683007-139683029 GACTTTCTGGTGGGAGAGAAAGG + Intronic
1034022453 7:147659831-147659853 AACAATCTCTTAGGGGAAAAAGG - Intronic
1036614222 8:10375940-10375962 GACTTTCTGATGGGGGAGGAAGG + Intronic
1037903898 8:22704074-22704096 AAAAAACTTTTGGGGGAGAAGGG - Intergenic
1039005093 8:33027212-33027234 AACATTGTGTTAGGGTACAAGGG - Intergenic
1040030752 8:42821533-42821555 ACCAGGTTGTTGGGGGAGAAGGG + Intergenic
1040081781 8:43292384-43292406 TCCAATCTGTTAGGGGAGAAAGG - Intergenic
1041903100 8:63003680-63003702 AACATTTTGCTGTGGGTGAAGGG + Intergenic
1041942840 8:63407880-63407902 AAGATTGGGTTGGCGGAGAAAGG - Intergenic
1044782209 8:95754787-95754809 AACGTTTTGTTGGGGGTGGAAGG - Intergenic
1046656965 8:116905426-116905448 AAAATTTGGTTGGGGGAAAATGG - Intergenic
1048568065 8:135624693-135624715 GACATTGTGTTGGGGAAGGAAGG - Intronic
1049926096 9:408923-408945 ATTACTCTTTTGGGGGAGAAAGG - Intronic
1051652253 9:19340033-19340055 AACATTCTGTTGTGCCAAAAAGG - Intronic
1051797816 9:20893812-20893834 ACCACTCTGGTGGGGGATAATGG - Intronic
1052001241 9:23283955-23283977 AAGATTCTGTAGTAGGAGAATGG - Intergenic
1052520407 9:29540753-29540775 CACATTGTTTTGGGGGAAAAGGG - Intergenic
1053795866 9:41726396-41726418 ACCATGCAGTTGGGGGAGCAGGG - Intergenic
1054149313 9:61588477-61588499 ACCATGCAGTTGGGGGAGCAGGG + Intergenic
1054184273 9:61938467-61938489 ACCATGCAGTTGGGGGAGCAGGG - Intergenic
1054469075 9:65519588-65519610 ACCATGCAGTTGGGGGAGCAGGG + Intergenic
1054654233 9:67650028-67650050 ACCATGCAGTTGGGGGAGCAGGG + Intergenic
1055439826 9:76326773-76326795 CACATTCTGTTAGGGAAGACAGG + Intronic
1055474058 9:76643778-76643800 AAAAATCTGCTGGCGGAGAAAGG + Intronic
1058024050 9:100120720-100120742 AACCTTCTGGTGGAGGGGAAGGG + Intronic
1058330031 9:103749156-103749178 AACATTCCTCTGGGGAAGAATGG - Intergenic
1059655581 9:116354640-116354662 GAGATGCTGTTGTGGGAGAATGG - Intronic
1060771451 9:126335042-126335064 ATTCTTCTGTTGGGGGGGAAAGG + Intronic
1061114663 9:128601991-128602013 AACATTCTGTTGAGGGGGTAAGG - Intronic
1189750955 X:44222312-44222334 AACAATCTTTTGGGGGTGAATGG - Intronic
1194247188 X:91529916-91529938 AACATTCGTTTGGTGCAGAAAGG + Intergenic
1195002035 X:100651175-100651197 TATATTCTGTTGGGGGTGATGGG + Intronic
1195032835 X:100943352-100943374 AACATACTGTTGAGGAAAAAAGG - Intergenic
1195903665 X:109823532-109823554 AAAATATTCTTGGGGGAGAAAGG + Intergenic
1196013460 X:110913032-110913054 ATGATTCTGTGGGGTGAGAAAGG - Intergenic
1200159091 X:153995594-153995616 AACATTCTCCTGGGGGACAAAGG - Intergenic
1200566208 Y:4771454-4771476 AACATTCATTTGGTGCAGAAAGG + Intergenic