ID: 981049056

View in Genome Browser
Species Human (GRCh38)
Location 4:140293178-140293200
Sequence GTGAGAAAACATTCTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981049056_981049064 17 Left 981049056 4:140293178-140293200 CCCCCAACAGAATGTTTTCTCAC 0: 1
1: 0
2: 2
3: 24
4: 183
Right 981049064 4:140293218-140293240 TGGGCTGCCACTAGGTGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 181
981049056_981049063 16 Left 981049056 4:140293178-140293200 CCCCCAACAGAATGTTTTCTCAC 0: 1
1: 0
2: 2
3: 24
4: 183
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049056_981049062 9 Left 981049056 4:140293178-140293200 CCCCCAACAGAATGTTTTCTCAC 0: 1
1: 0
2: 2
3: 24
4: 183
Right 981049062 4:140293210-140293232 TAAACAACTGGGCTGCCACTAGG No data
981049056_981049060 -3 Left 981049056 4:140293178-140293200 CCCCCAACAGAATGTTTTCTCAC 0: 1
1: 0
2: 2
3: 24
4: 183
Right 981049060 4:140293198-140293220 CACATGAAATCTTAAACAACTGG 0: 1
1: 1
2: 0
3: 13
4: 211
981049056_981049061 -2 Left 981049056 4:140293178-140293200 CCCCCAACAGAATGTTTTCTCAC 0: 1
1: 0
2: 2
3: 24
4: 183
Right 981049061 4:140293199-140293221 ACATGAAATCTTAAACAACTGGG 0: 1
1: 0
2: 2
3: 15
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981049056 Original CRISPR GTGAGAAAACATTCTGTTGG GGG (reversed) Intronic
900981433 1:6048314-6048336 GCCAGAAGACAGTCTGTTGGGGG - Intronic
903040909 1:20529591-20529613 GTGAGCTTACATTCTATTGGAGG - Intergenic
907688929 1:56643917-56643939 GTAAAAAAAAATTCTGTTTGGGG - Intronic
911033688 1:93516259-93516281 GTGAGAAAACATCCTGGAAGGGG + Intronic
915106252 1:153536651-153536673 CTGAGAAAAGATTTTGATGGAGG + Intergenic
917194077 1:172447998-172448020 GGGAGAAGACATTCTGTGGGAGG + Intronic
920453363 1:206077805-206077827 GTGAGAAAACAATGTGTTCAGGG - Intronic
920591628 1:207224540-207224562 ATGATAAAACATTCTCTTTGTGG + Intergenic
923749200 1:236731636-236731658 GGGAGAAAACATTATGTTGTTGG - Intronic
924188784 1:241525714-241525736 GGTAGAAAGCATTGTGTTGGAGG - Intergenic
924724561 1:246657159-246657181 GTAAGAAAAAATTCTGTTACAGG + Intronic
924851623 1:247837111-247837133 GAAAGAAAAAATTGTGTTGGAGG - Intergenic
1063094090 10:2893959-2893981 TTGAGAACACACTCTGTTGTAGG + Intergenic
1063267385 10:4468820-4468842 TTGAGAAGATATTGTGTTGGTGG + Intergenic
1063287577 10:4707344-4707366 GGGAGAAACCCTTCTGCTGGTGG + Intergenic
1064644420 10:17446349-17446371 TTTAGAAAACATTCCCTTGGTGG + Intronic
1068205398 10:53844195-53844217 GTGAGATAAGAATCTGTTGCTGG + Intronic
1068316951 10:55357754-55357776 GTAAGAAAACATACTTTTGGTGG + Intronic
1068688026 10:59889268-59889290 GTGAGAAAGCATTCTATGGGAGG + Intronic
1070354004 10:75621446-75621468 ATCAAAAAATATTCTGTTGGTGG + Intronic
1072593721 10:96851870-96851892 GTGAGAAAATAATGTGTTTGGGG - Intronic
1074687007 10:115970860-115970882 GTGAGAAAACAATCAGATTGAGG + Intergenic
1075384328 10:122044183-122044205 ATCAGAAAACATTCCGTTTGCGG + Intronic
1075898107 10:126015729-126015751 ATGAGAAAGCCTTCTTTTGGGGG - Exonic
1078275325 11:9839506-9839528 GAGTGAATACATCCTGTTGGAGG + Exonic
1080443327 11:32314867-32314889 AACAGCAAACATTCTGTTGGGGG - Intergenic
1081036142 11:38148868-38148890 CTGAGAAAATATTCAGCTGGAGG + Intergenic
1084472742 11:69372756-69372778 TGGAGACAACATTCTGGTGGAGG + Intergenic
1085149613 11:74239474-74239496 GTGAGAAAGCAGTCTGTTTTAGG - Intronic
1085469563 11:76748528-76748550 GCCAGAAAATATTCTGATGGAGG - Intergenic
1085858855 11:80208230-80208252 TTTATAAAACATTCTATTGGTGG + Intergenic
1088542155 11:110924332-110924354 GTGAGAAAACAATGGGTCGGGGG - Intergenic
1089028366 11:115295767-115295789 GTGAGAGAACAGTATGTTGTAGG - Intronic
1090420170 11:126569345-126569367 GAGGGTAAACATTTTGTTGGGGG + Intronic
1091493435 12:952126-952148 GTAAAAAAACATTTTTTTGGTGG + Intronic
1093936176 12:25003022-25003044 GTGGTAAAGGATTCTGTTGGTGG + Intergenic
1096760692 12:53839578-53839600 GTGAGAAGACATACCGTGGGTGG + Intergenic
1096768593 12:53916021-53916043 ATGAGAAAACATTCTGGAAGTGG - Intergenic
1097100146 12:56582085-56582107 CTGAGCAAGCATCCTGTTGGGGG - Exonic
1099058005 12:77869287-77869309 GTAAGTAAATATTCTATTGGGGG + Intronic
1100094285 12:91012488-91012510 TGGAGATAACATTCTGGTGGAGG - Intergenic
1102608638 12:114091101-114091123 ATCATAAAACATTTTGTTGGAGG + Intergenic
1102695531 12:114796336-114796358 GTCCGTAAACATTGTGTTGGGGG - Intergenic
1102850774 12:116242455-116242477 GTGAGAAATAATTGTGTTTGGGG - Intronic
1105774078 13:23640138-23640160 GTTATAAAACATGCTGTGGGAGG + Intronic
1107758793 13:43653905-43653927 GGGAGTAAAGATTCTGTTAGTGG - Intronic
1111166110 13:84459207-84459229 TTTGGAAAACAGTCTGTTGGTGG - Intergenic
1112202508 13:97290789-97290811 GATAGAAAACATTGTGATGGGGG + Intronic
1113048180 13:106179306-106179328 GAGTGAAAACATTTTATTGGAGG + Intergenic
1113580159 13:111422993-111423015 GTAGGAAAAAATTCTGTTTGGGG - Intergenic
1116650548 14:47586255-47586277 GTGTGAAGACATTGTGTTGTTGG - Intronic
1116893707 14:50294749-50294771 TTTACAAAACATTCTGTTGCAGG + Intronic
1117215059 14:53542875-53542897 GTGGGGAAACATTATGTTGAGGG - Intergenic
1117288764 14:54312367-54312389 TTGAGAAAGCATTCAGTGGGAGG + Intergenic
1117335474 14:54753904-54753926 TTGAGAAACCATTCTCTTTGGGG + Intronic
1118070250 14:62238821-62238843 AGGAAAAAACATTCAGTTGGGGG + Intergenic
1118437224 14:65782614-65782636 TTAAGCAAACATTCTGGTGGAGG - Intergenic
1119060612 14:71470452-71470474 GTAAGAAATCATTCTGCAGGTGG - Intronic
1120225435 14:81786235-81786257 AAGAGAAAACATTCCGTTGGAGG - Intergenic
1120568036 14:86083332-86083354 ATGAGAAAACATGCTGTTAGAGG - Intergenic
1121562438 14:94885360-94885382 AAGTGAACACATTCTGTTGGGGG - Intergenic
1121613472 14:95296958-95296980 AAGAGAACACCTTCTGTTGGAGG + Intronic
1122157465 14:99758767-99758789 GTGAGCAAGCCTTCTGTTGCAGG - Intronic
1122385612 14:101343753-101343775 GTGAGAACACAATCTGTTCCTGG - Intergenic
1125916497 15:43492798-43492820 TTTAGAAAACATTCTTTTGGGGG - Intronic
1127251916 15:57247655-57247677 GTGAGGAAAATTTTTGTTGGTGG - Intronic
1134206398 16:12241824-12241846 GAGAGAAAACAGTCTGATGATGG - Intronic
1134560844 16:15208120-15208142 GTGAGATATCATCCCGTTGGAGG + Intergenic
1134921381 16:18119740-18119762 GTGAGATATCATCCCGTTGGAGG + Intergenic
1137117806 16:36662828-36662850 GTTAGGAAACACTCTGTTTGTGG + Intergenic
1137122015 16:36732241-36732263 GTTAGGAAACACTCTGTTTGTGG + Intergenic
1137195728 16:37952806-37952828 GTTAGGAAACACTCTGTTTGTGG + Intergenic
1140060873 16:71568600-71568622 ATGAGAAGACATTTTGTTGGAGG + Intronic
1143970800 17:10794097-10794119 TTGGGAAGACATTGTGTTGGAGG - Intergenic
1146070425 17:29675890-29675912 GTGAGAAAACATGCTTTGGATGG - Intronic
1149604285 17:57913917-57913939 GTGAGAAGACTTTCTGGAGGAGG - Intronic
1149733589 17:58971238-58971260 GTGGGAAGACATTTTATTGGTGG + Intronic
1153094440 18:1384216-1384238 GAGATAAAACAGTCTTTTGGAGG - Intergenic
1153407681 18:4758958-4758980 TTGGGAAAACATCCTGGTGGAGG + Intergenic
1153537871 18:6122157-6122179 ATGTGAAAACATTCTGTTAGTGG + Intronic
1153799597 18:8657771-8657793 GTGAGAAAACAATATCTTGGTGG - Intergenic
1154261656 18:12839824-12839846 CTCAGAAAACATGCTGTTTGAGG - Intronic
1155182993 18:23364284-23364306 GTGAGTAAACATTCATTTTGTGG + Intronic
1155645966 18:28078066-28078088 GTCAGAATATATTCTGTGGGAGG - Intronic
1158575850 18:58637198-58637220 GTCAGAAAATATTCTATTGTAGG - Intergenic
1158825706 18:61216363-61216385 GTGAGAATATGTTCTTTTGGAGG + Intergenic
1158956337 18:62543281-62543303 AGGAGAAAACATTCTAGTGGAGG - Intronic
1160336267 18:78043001-78043023 TTTAGAACACATTCTGTTTGAGG + Intergenic
1161943940 19:7422689-7422711 GTTAGAACACATTTTGTTGTGGG - Intronic
1166191058 19:41176965-41176987 CTGGGAAAACATTCTTTTGCAGG - Intergenic
1167812172 19:51842958-51842980 GTGAGAAAAAGTTCTGTTTCAGG + Intergenic
925240498 2:2321577-2321599 TTGAAAAACCATTCTGTTGAGGG + Intronic
927322915 2:21769266-21769288 GAGAGAAGTTATTCTGTTGGTGG + Intergenic
929772214 2:44902007-44902029 GTGATAAAACAAACTGTTAGTGG + Intergenic
930231592 2:48849108-48849130 GTGAGCAAACTTTCTGTTAAAGG - Intergenic
931889455 2:66655150-66655172 GTGAGCACACATTCAGTTGGTGG - Intergenic
933415563 2:81982769-81982791 TTGAGAAAACATGCTGGTGGGGG - Intergenic
937922935 2:127145043-127145065 GTGACAAGAAAGTCTGTTGGAGG - Intergenic
938805189 2:134800536-134800558 CTGACATATCATTCTGTTGGTGG + Intergenic
938809158 2:134836211-134836233 GTGAGACAATACTTTGTTGGGGG + Intergenic
939026701 2:137022781-137022803 GTCAGCAAACATTCTGTGGAAGG + Intronic
939256607 2:139751718-139751740 GTTAGAGAACATTCTGCTGAGGG + Intergenic
942844193 2:180403454-180403476 GTGAGCAAACTTTCCATTGGAGG + Intergenic
942904428 2:181163977-181163999 GAAAAAAAACATTCTTTTGGTGG - Intergenic
942988057 2:182165221-182165243 GTGAGAAAAAATTTTGCTAGTGG - Intronic
944821401 2:203435828-203435850 GTGACAAAGATTTCTGTTGGTGG + Exonic
946064185 2:216972301-216972323 GGGAGAAAACACTCTAGTGGAGG + Intergenic
1170180990 20:13529919-13529941 GTGGGAACACATTCTGTTTACGG + Intronic
1182228622 22:28819599-28819621 ATGAAAAAACATTCTTTTGCTGG - Intergenic
1182412154 22:30196375-30196397 GTCAGACAGCATTGTGTTGGGGG + Intergenic
953514878 3:43580203-43580225 GTGGGAAAACATTTTGATGGAGG - Intronic
953691845 3:45126362-45126384 GTTAGAATGAATTCTGTTGGAGG - Intronic
955029324 3:55201135-55201157 GTGCGAACACATTCTGGAGGGGG + Intergenic
956622401 3:71234506-71234528 GTGACGAAACTTTCTGTAGGCGG - Intronic
956713378 3:72057703-72057725 GTGAGAAAAGGTTCTCTTGGAGG - Intergenic
957622316 3:82609841-82609863 GTGGGAAAATATTCTGTTTGTGG + Intergenic
960396922 3:117148834-117148856 GAGAGAGAAGATTCTGTTGCAGG + Intergenic
960723919 3:120651174-120651196 GGAAGAAGAGATTCTGTTGGAGG + Intronic
961056709 3:123794825-123794847 TTGAGAATACATTCTGTTCCAGG + Intronic
963369212 3:144376778-144376800 GTGAAAAAACAATGTGTTCGGGG + Intergenic
963519241 3:146344824-146344846 GAGAGAACACATTCTGTGGTAGG + Intergenic
963677098 3:148326015-148326037 GTGAGAACACATGCTGTATGTGG - Intergenic
963741873 3:149088853-149088875 TAGAGAAAACATACTGTGGGAGG - Intergenic
963800542 3:149671473-149671495 GTTTTAAAACATTCTGTTAGGGG - Intronic
964790305 3:160448611-160448633 TTGAAAAAACATTGTGTTGGCGG - Intronic
965820212 3:172677620-172677642 GTGACAAAGCAAGCTGTTGGTGG + Intronic
966727063 3:183117464-183117486 CTGAGAAAAGATGCTTTTGGAGG - Intergenic
967755476 3:193163526-193163548 AGGAGAAAATATTCAGTTGGAGG + Intergenic
968861125 4:3170972-3170994 GTGAGAAAGCATGCTGTTTCTGG - Intronic
973879862 4:55259160-55259182 TTAAGAAAACATTATTTTGGGGG + Intergenic
975931026 4:79522773-79522795 GTAAGAAAACATTTAGGTGGAGG + Intergenic
975996258 4:80319875-80319897 ATGAGTAAAAATTCTGATGGTGG - Intronic
976940747 4:90699484-90699506 TTGAGAGAACTTTCTGTTTGGGG - Intronic
978379593 4:108112963-108112985 GTCAGAAACCACCCTGTTGGAGG + Intronic
981049056 4:140293178-140293200 GTGAGAAAACATTCTGTTGGGGG - Intronic
981132922 4:141178188-141178210 TTGAGAAAACATTCTGTCTAAGG - Intronic
983361707 4:166733189-166733211 GTTAAAAAAAATTTTGTTGGTGG - Intergenic
985841601 5:2310003-2310025 GTGAGAGCACATTCAGTTTGGGG - Intergenic
985893347 5:2733425-2733447 CTGGGAAGACATTCTGGTGGTGG + Intergenic
989837795 5:46015830-46015852 GAGATAAAACATTCCTTTGGTGG + Intergenic
991569423 5:68038644-68038666 GTGACAAAGTATTGTGTTGGGGG + Intergenic
994111573 5:96010729-96010751 ATGGAAAAACATTCTGTTGATGG - Intergenic
995333428 5:110971608-110971630 GTCAGAAAAAGTTTTGTTGGTGG + Intergenic
997732186 5:136189801-136189823 GTGAGAGCACATCCTGTTGGTGG + Intergenic
999931887 5:156442435-156442457 GAGTTAAAAAATTCTGTTGGTGG + Intronic
1000446087 5:161322922-161322944 GTGAGAAAATATTTTGTTACAGG + Intronic
1002126474 5:177049113-177049135 ATGAGAAAATATTCTGTTTGTGG - Intronic
1002806609 6:582357-582379 GTGAGAAAACTTGCTGTAGTAGG - Intronic
1004528494 6:16431290-16431312 TTGAGAGAACATTCTGCTGGGGG + Intronic
1005847803 6:29794916-29794938 TTCTGAAAACATTCAGTTGGAGG - Intergenic
1008166858 6:48149627-48149649 GTGAAGAAACTTTTTGTTGGTGG - Intergenic
1008604842 6:53130399-53130421 CTAAGAAAACAATCTGTTTGGGG + Intronic
1010011586 6:71053694-71053716 ATGAGAGAACACTCTGCTGGTGG + Intergenic
1013308919 6:108875103-108875125 GTGAGAAAACATTTTGTTAAAGG - Intronic
1013573694 6:111456648-111456670 CTGAGAAAAGATTGTTTTGGGGG - Intronic
1013600743 6:111702543-111702565 GTGAGAAAGCAGTCTCTCGGAGG - Intronic
1014239456 6:118998947-118998969 GTTAGAAAATAATCTGTAGGTGG + Intronic
1014575977 6:123073469-123073491 ATGAGAAAACAGTGTGCTGGAGG - Intergenic
1016609945 6:145977375-145977397 GTGAGAGAACTGCCTGTTGGAGG + Intergenic
1017392020 6:153950809-153950831 GTTAGAAAACATACTTTGGGAGG + Intergenic
1018867475 6:167757531-167757553 GTGAGAATGCATTCTGTTGGAGG - Intergenic
1019310747 7:359481-359503 GTGAGAAAACACCCTTTGGGAGG - Intergenic
1019585749 7:1802323-1802345 GTGAGAAAAAGTTCAGTTGCAGG + Intergenic
1020913454 7:14162229-14162251 GTTAGAAATCTTTCTGCTGGTGG - Intronic
1021032935 7:15761331-15761353 GTGAGAACACATTCTATGGGAGG + Intergenic
1024848085 7:53673975-53673997 ATGACAAAACATTATGTTGCCGG + Intergenic
1025153182 7:56576666-56576688 GATATAAAACATTCTTTTGGGGG + Intergenic
1027435585 7:78160708-78160730 CTGAGAAAACATTCTGTGGGTGG - Intronic
1031563813 7:123269829-123269851 GTGTGAACTCATTCAGTTGGAGG - Intergenic
1031765116 7:125768498-125768520 CTGAGAAAACAATGTTTTGGGGG + Intergenic
1034944314 7:155252047-155252069 CCAAGAAAACATTCTGTTTGTGG + Intergenic
1035713996 8:1739861-1739883 GTGAGAAATCATTCTGCTCGTGG - Intergenic
1036473634 8:9073396-9073418 GTGAGAGAAGATACAGTTGGGGG + Intronic
1039143810 8:34422855-34422877 GTGAGCAAACATTCTCTAGAAGG - Intergenic
1041342061 8:56856481-56856503 GTGGGAAAAGATTGTGTTGGAGG + Intergenic
1043166215 8:76906043-76906065 ATGAGGAGGCATTCTGTTGGAGG - Intergenic
1045659340 8:104420554-104420576 GTGCAAAAACATTCTGATGATGG + Intronic
1046707847 8:117476119-117476141 GTGAGAAAGCTTTTTCTTGGGGG + Intergenic
1046709877 8:117499084-117499106 AAGAGGAAACATTCAGTTGGTGG - Intergenic
1050610327 9:7345517-7345539 GTAAGAAAATATTTTATTGGAGG - Intergenic
1051917719 9:22228300-22228322 TTCAGGAAGCATTCTGTTGGTGG + Intergenic
1052030075 9:23618625-23618647 GTGAGAAAACATGGTGCTAGAGG + Intergenic
1052244179 9:26313635-26313657 GTGACAAAACATTTTGGTGTGGG + Intergenic
1055241154 9:74188109-74188131 GCCAGAAAATATTCAGTTGGGGG - Intergenic
1055735315 9:79322391-79322413 GTTAGGGACCATTCTGTTGGTGG + Intergenic
1056070111 9:82977403-82977425 AAGAGATTACATTCTGTTGGGGG - Intergenic
1056480821 9:87003940-87003962 CTGAGTAAACATTCTGTTCAGGG - Intergenic
1058727899 9:107820917-107820939 TTGAGAAAACATGTTGCTGGTGG + Intergenic
1060540631 9:124427968-124427990 ATGAGGAAACTTTCTGATGGTGG - Intergenic
1062148389 9:135004090-135004112 TTGAGAAACCATTGTGTTAGAGG - Intergenic
1185939636 X:4301449-4301471 TGGAGAAAAAATTATGTTGGGGG - Intergenic
1186684488 X:11911330-11911352 GTGAGAGGACATTCTGTTCAGGG + Intergenic
1186978081 X:14929680-14929702 CTGAGAATACATTGTGTTGAGGG + Intergenic
1187142818 X:16610571-16610593 AAAAGAAAACATACTGTTGGTGG + Intronic
1188402401 X:29762035-29762057 GTTAGAAAATACTCTGTTGATGG + Intronic
1188453298 X:30332420-30332442 GTAAGAAAACACTCACTTGGAGG + Intergenic
1190512617 X:51189365-51189387 ATGAGAACACTTTCAGTTGGAGG + Intergenic
1192896472 X:75447709-75447731 GGAAGAAAACATTTTGTTAGTGG - Intronic
1194122588 X:89978065-89978087 GTGAGAATATTTTCTTTTGGAGG - Intergenic
1194609097 X:96018685-96018707 GTGAGAAAACATTATGATATTGG + Intergenic
1196023378 X:111013697-111013719 ATAAGAAGAAATTCTGTTGGGGG - Intronic
1196919208 X:120568531-120568553 GAGAGAAATAATGCTGTTGGTGG - Intronic
1198325904 X:135572884-135572906 GTGAAAAATCATTCTGGAGGTGG + Exonic
1199769154 X:150963132-150963154 GTGAGGATACATCCTGGTGGGGG - Intergenic
1200475447 Y:3635504-3635526 GTGAGAATATTTTCTTTTGGAGG - Intergenic
1200705580 Y:6439725-6439747 GTGAGGATACATTCTGGTGAGGG - Intergenic
1200921404 Y:8616657-8616679 GTGAGAATACAATCTGGTGAGGG + Intergenic
1200933532 Y:8718639-8718661 GTGAGAATACATTCTGATGAGGG - Intergenic
1200934441 Y:8725868-8725890 GTGAGAATACAATCAGTTGAGGG - Intergenic
1201028531 Y:9724983-9725005 GTGAGGATACATTCTGGTGAGGG + Intergenic