ID: 981049057

View in Genome Browser
Species Human (GRCh38)
Location 4:140293179-140293201
Sequence TGTGAGAAAACATTCTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981049057_981049063 15 Left 981049057 4:140293179-140293201 CCCCAACAGAATGTTTTCTCACA 0: 1
1: 0
2: 1
3: 18
4: 268
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049057_981049060 -4 Left 981049057 4:140293179-140293201 CCCCAACAGAATGTTTTCTCACA 0: 1
1: 0
2: 1
3: 18
4: 268
Right 981049060 4:140293198-140293220 CACATGAAATCTTAAACAACTGG 0: 1
1: 1
2: 0
3: 13
4: 211
981049057_981049064 16 Left 981049057 4:140293179-140293201 CCCCAACAGAATGTTTTCTCACA 0: 1
1: 0
2: 1
3: 18
4: 268
Right 981049064 4:140293218-140293240 TGGGCTGCCACTAGGTGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 181
981049057_981049062 8 Left 981049057 4:140293179-140293201 CCCCAACAGAATGTTTTCTCACA 0: 1
1: 0
2: 1
3: 18
4: 268
Right 981049062 4:140293210-140293232 TAAACAACTGGGCTGCCACTAGG No data
981049057_981049061 -3 Left 981049057 4:140293179-140293201 CCCCAACAGAATGTTTTCTCACA 0: 1
1: 0
2: 1
3: 18
4: 268
Right 981049061 4:140293199-140293221 ACATGAAATCTTAAACAACTGGG 0: 1
1: 0
2: 2
3: 15
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981049057 Original CRISPR TGTGAGAAAACATTCTGTTG GGG (reversed) Intronic
900252710 1:1679445-1679467 TGTGAGCAAACATTAGGGTGGGG - Intronic
902963021 1:19978123-19978145 TGTGAGGAGACACCCTGTTGGGG + Intronic
902971415 1:20054950-20054972 TCTAATAAAACATTCTGTTGGGG - Intronic
905418705 1:37823700-37823722 TGTGACAAACCTGTCTGTTGAGG + Exonic
906807140 1:48790004-48790026 TGTCAGAAAACATTCACTTAGGG + Intronic
909950960 1:81719908-81719930 TGGGAGAAAACATGATTTTGTGG + Intronic
910798376 1:91120776-91120798 TATGAGAAAACATTGGGTTGGGG + Intergenic
911807764 1:102233622-102233644 TATGAGAAAACATTTTTTTCAGG + Intergenic
912332130 1:108829680-108829702 TGTTAGAAAGCATTCCATTGTGG - Intronic
914215351 1:145622104-145622126 TGTGTGTATACATTCTGGTGTGG - Intronic
916465781 1:165073455-165073477 TGGGAGAAAACAATCCCTTGTGG + Intergenic
916762902 1:167833078-167833100 TGTAAGGAAAGATTCGGTTGAGG + Exonic
918932593 1:190874655-190874677 TCTGATAAAATATTCTCTTGTGG + Intergenic
918971788 1:191429105-191429127 TTTGAGGAAACATTTTGTTCAGG + Intergenic
920404772 1:205701141-205701163 TTTCAGAAAACAGTCAGTTGGGG - Intergenic
920453364 1:206077806-206077828 GGTGAGAAAACAATGTGTTCAGG - Intronic
924014645 1:239707736-239707758 TGTCAGCAATTATTCTGTTGAGG + Intronic
924368137 1:243318657-243318679 TCTGAGGAAACAGTATGTTGGGG - Intronic
924822241 1:247504456-247504478 TGAGAAAGAACATTCTATTGTGG + Intergenic
1063567019 10:7180082-7180104 TGGGAGAAAGCCTTCAGTTGTGG + Intronic
1064884819 10:20099516-20099538 TTTGAAACAACATTCTTTTGAGG - Intronic
1068124278 10:52818838-52818860 TGAGAGAAAATTTTTTGTTGTGG - Intergenic
1068744190 10:60511008-60511030 AGTGAGAAAACATTTTTTTAAGG + Intronic
1069338569 10:67383499-67383521 TGTGAGACTACATTATGTAGTGG - Intronic
1070118589 10:73553193-73553215 GGTGAGAAAAGATTATATTGTGG - Intronic
1071000293 10:80824004-80824026 TGTGAGGAAACATTGAGTTTTGG + Intergenic
1072500313 10:96009612-96009634 TGAGAGAAAATTATCTGTTGTGG - Intronic
1072532597 10:96333257-96333279 TGTGAGATAACATCTTATTGTGG - Intronic
1072959105 10:99913590-99913612 TGTGATAAAACAATTAGTTGTGG + Intronic
1075898108 10:126015730-126015752 TATGAGAAAGCCTTCTTTTGGGG - Exonic
1081944028 11:46972738-46972760 ACTGAGGAAACATTCTGTTCAGG - Intronic
1082003017 11:47404131-47404153 TGTCAGAAAACACTCATTTGTGG + Intergenic
1082614920 11:55348103-55348125 TGTGAGATAACATTTAATTGTGG + Intergenic
1085453238 11:76650297-76650319 TGAGAGAAGAAATTCTATTGTGG + Intergenic
1087211903 11:95453515-95453537 TGTGAAAAGACATACTGGTGAGG - Intergenic
1087793826 11:102434292-102434314 TGTGAGAAGACATTTCATTGTGG + Intronic
1090031961 11:123214565-123214587 TGTCAAAATACACTCTGTTGTGG - Intergenic
1090459153 11:126874679-126874701 TTTGAGGAAACATTTTGTAGAGG - Intronic
1092960304 12:13590812-13590834 TGTGAGAAACCATTTCCTTGGGG + Intronic
1093885500 12:24455292-24455314 TTTAAGAAAAGATTCTGTTCAGG - Intergenic
1094292125 12:28863269-28863291 TTTTAGATAACATTCTTTTGTGG + Intergenic
1094346744 12:29478432-29478454 TGTCAGAAAACTTCCTTTTGAGG - Intronic
1095048219 12:37533584-37533606 GGTGAGGATACAATCTGTTGAGG + Intergenic
1095396540 12:41768580-41768602 TGTGAGAATAGATTTTTTTGAGG - Intergenic
1096907713 12:54950355-54950377 TGTCAGACCACATGCTGTTGTGG + Exonic
1097136016 12:56856406-56856428 TGGGTGAAAACATTCTGTAATGG + Intergenic
1097908882 12:64948265-64948287 TGTGAGAAAACCTCCTGGAGTGG - Intergenic
1098777311 12:74636784-74636806 TTTGAGAAAACATTGTGAGGTGG - Intergenic
1098853364 12:75624304-75624326 TGCTAGTAAACATTCTTTTGAGG - Intergenic
1100128849 12:91464908-91464930 TGATAGAAAAATTTCTGTTGTGG - Intergenic
1102695532 12:114796337-114796359 TGTCCGTAAACATTGTGTTGGGG - Intergenic
1103830555 12:123775736-123775758 TGTGGGAAAACATATTGCTGGGG + Intronic
1104362493 12:128147159-128147181 TGTAAGAAACCATACTTTTGTGG + Intergenic
1106665747 13:31848516-31848538 TGGGAGAAAACACTCTGTAAAGG - Intergenic
1108801449 13:54101067-54101089 TGGGACAAAATATTCTGGTGTGG + Intergenic
1110040350 13:70747480-70747502 TATATGGAAACATTCTGTTGAGG - Intergenic
1111573141 13:90114120-90114142 TGTGACAAACCATTCTGATCAGG - Intergenic
1111982424 13:95030757-95030779 TGTGAGAACATAATCTGCTGTGG + Intronic
1112202507 13:97290788-97290810 TGATAGAAAACATTGTGATGGGG + Intronic
1112216790 13:97438999-97439021 TGTGAGAACACTTCCAGTTGGGG + Intronic
1113580160 13:111422994-111423016 TGTAGGAAAAAATTCTGTTTGGG - Intergenic
1114775574 14:25477148-25477170 TGTGAAAAAACACTTTTTTGGGG + Intergenic
1114919372 14:27307359-27307381 TGTGAGAGAACATTCTAAGGAGG - Intergenic
1116244344 14:42389929-42389951 TGTGAGAATAGATTGTGATGGGG + Intergenic
1117215060 14:53542876-53542898 AGTGGGGAAACATTATGTTGAGG - Intergenic
1117324976 14:54660403-54660425 TGTGACAAAACTTTATGCTGGGG - Intronic
1117543420 14:56770663-56770685 TGGAAGAATACATTCTGTAGGGG + Intergenic
1122551081 14:102550337-102550359 TGCGAGAGATCATTCTGTGGAGG - Intergenic
1123267572 15:17752783-17752805 TCTGAGAAAACATCCTTGTGAGG + Intergenic
1125409088 15:39386045-39386067 TGTTAAAAAATATTCTGTTTAGG - Intergenic
1125452343 15:39822563-39822585 ACTGAGAAAACATTATTTTGTGG - Intronic
1125916498 15:43492799-43492821 TTTTAGAAAACATTCTTTTGGGG - Intronic
1126459618 15:48901099-48901121 TGTCACAAAATATTCTTTTGGGG + Intronic
1126730430 15:51676409-51676431 TGTGAGAACACATTGTGATAAGG - Intergenic
1127617122 15:60697324-60697346 TTTGAAAAAACAGTTTGTTGGGG - Intronic
1128210905 15:65901727-65901749 TGTTAGAAAATATGCAGTTGAGG - Intronic
1129303831 15:74643776-74643798 TCTGAGATAACACTTTGTTGTGG - Intronic
1131978553 15:97971887-97971909 TGTGAAAACACGTTTTGTTGAGG + Exonic
1134516446 16:14891143-14891165 TTTGACAAAATACTCTGTTGGGG - Intronic
1134704119 16:16289795-16289817 TTTGACAAAATACTCTGTTGGGG - Intronic
1134963424 16:18422319-18422341 TTTGACAAAATACTCTGTTGGGG + Intronic
1134967719 16:18504918-18504940 TTTGACAAAATACTCTGTTGGGG + Intronic
1135161985 16:20104584-20104606 TATGAGACAACATTGTTTTGAGG - Intergenic
1135351224 16:21730790-21730812 AGTGAAAAAACATGCTGTGGTGG - Intronic
1135449705 16:22546916-22546938 AGTGAAAAAACATGCTGTGGTGG - Intergenic
1137331204 16:47498565-47498587 AGGCAGAAAACATTCTGTTCTGG - Intronic
1138135668 16:54519474-54519496 ACTGAAAAAACATTCTGCTGAGG - Intergenic
1138423107 16:56912685-56912707 TGTGAGCGAACATTCTAATGTGG + Intronic
1138775351 16:59716199-59716221 TTTGTGAAGATATTCTGTTGTGG + Intronic
1139842829 16:69895325-69895347 TGTGAGAAAACAGTCCTTTTTGG + Intronic
1144438145 17:15259614-15259636 TGTGAGAAATAATTATGTTGGGG - Intronic
1144806326 17:17970636-17970658 GGTGGGAAAACACTCTTTTGGGG + Intronic
1145411484 17:22669765-22669787 GGTGAGGATACAGTCTGTTGAGG + Intergenic
1147807673 17:43143784-43143806 TTTCAGAAAACATACTGGTGGGG - Intergenic
1149054608 17:52348424-52348446 TGTAAAATAATATTCTGTTGTGG + Intergenic
1149081434 17:52662689-52662711 TGTGGGAAAAAAATCTGATGAGG - Intergenic
1153449163 18:5207605-5207627 TGATAGGAAACATTCTGTCGAGG - Intergenic
1153663701 18:7349449-7349471 TGTGAGAAAATGCACTGTTGTGG - Intergenic
1155409525 18:25527136-25527158 TGTGAGAAATCATTTTGTGATGG - Intergenic
1156625875 18:38908245-38908267 TGTAAGTAAACATTCTGAGGGGG - Intergenic
1156793867 18:41015685-41015707 TGCTAGAAAGCATTCTGTTCTGG + Intergenic
1157092317 18:44650636-44650658 TGTGTGCAAACAGACTGTTGAGG + Intergenic
1157949399 18:52017715-52017737 TTTGAGAAAACAGTCTCCTGTGG + Intergenic
1160343710 18:78111883-78111905 TGTGAGAAAATTTTCTTTAGGGG + Intergenic
1161099783 19:2415900-2415922 TGTCAGAAACCATCCTGCTGGGG + Intronic
1161636118 19:5390296-5390318 TGGGAGAAAAGTTTCTGTGGGGG + Intergenic
1161943941 19:7422690-7422712 AGTTAGAACACATTTTGTTGTGG - Intronic
1164048247 19:21561479-21561501 TGTGAGAAAGTATTTTGCTGTGG - Intergenic
1164355592 19:27424766-27424788 TGTGAGAAAATTTTCTGTGATGG + Intergenic
1164645390 19:29855455-29855477 TTTGAGAAAAACTTATGTTGTGG - Intergenic
1164947522 19:32309026-32309048 TGTGAGAAAATATTAGGTTGAGG + Intergenic
1168667534 19:58215760-58215782 TTTGAGAACACATGCAGTTGAGG + Intergenic
925240497 2:2321576-2321598 TTTGAAAAACCATTCTGTTGAGG + Intronic
925797258 2:7559776-7559798 TGTGAGATAATATCTTGTTGTGG - Intergenic
926665750 2:15520714-15520736 TATGATAAAATATTCTTTTGAGG + Intronic
929550624 2:42888629-42888651 TGTGGGAAAAGACTCTCTTGGGG - Intergenic
929794035 2:45044885-45044907 TGTCAGGAAACACTCTGGTGAGG - Intergenic
931348070 2:61464981-61465003 TGTGGGATTACATTCTGTTTAGG - Intronic
932540617 2:72648220-72648242 TGTGAGAAAATATTTCATTGTGG - Intronic
933415564 2:81982770-81982792 CTTGAGAAAACATGCTGGTGGGG - Intergenic
933469633 2:82705186-82705208 TGTGAGAACAAATTCAGTTTAGG - Intergenic
935358571 2:102227679-102227701 TGTCAGAAAACAATCAGTGGTGG - Intronic
935428442 2:102946232-102946254 TATGAGGAAGCCTTCTGTTGGGG + Intergenic
935934220 2:108164482-108164504 TGTGAGAAGACATGCTATTTGGG - Intergenic
937174874 2:119920186-119920208 TGTGCAAAAAAATTCTTTTGAGG - Exonic
938809157 2:134836210-134836232 TGTGAGACAATACTTTGTTGGGG + Intergenic
939192121 2:138929368-138929390 TGTGAGCTAACATTGTGTTAGGG - Intergenic
939256606 2:139751717-139751739 AGTTAGAGAACATTCTGCTGAGG + Intergenic
940518459 2:154712675-154712697 TATCAGATAACATTGTGTTGCGG + Intronic
941346811 2:164379679-164379701 TGTGAGAAAATATTTTTTTCTGG - Intergenic
943201513 2:184832408-184832430 TGTTAGAAAACACTCTTTTTTGG + Intronic
943509429 2:188805436-188805458 TGTCAGAATTCATTCTCTTGTGG - Intergenic
946945775 2:224820493-224820515 TGTGAGTAAACATGCTGCTTGGG + Intronic
948698703 2:239747411-239747433 TGTGAGCACACGTGCTGTTGAGG - Intergenic
1171399541 20:24863645-24863667 TTTGAGATGACATTTTGTTGGGG - Intergenic
1171542754 20:25977061-25977083 GGTGAGGATACAATCTGTTGAGG + Intergenic
1171845790 20:30273710-30273732 GGTGAGGATACAGTCTGTTGAGG + Intergenic
1173406263 20:42768328-42768350 TGTGAGAAAGCAGTCTGGGGAGG - Intronic
1177612695 21:23472978-23473000 TGTGAGAAAAAATTATAATGAGG + Intergenic
1177759909 21:25391691-25391713 TGTTAGAAACCACTCTGTAGAGG - Intergenic
1178154563 21:29836261-29836283 TGAGAAATAACATTCTCTTGGGG + Intronic
1179371010 21:40806006-40806028 TCTTAGAAAACATTGTGTTTAGG - Intronic
1179482044 21:41684753-41684775 TTTGGGAAAACATTTTGTGGAGG - Intergenic
950100582 3:10354169-10354191 CTTAAGAAAACATCCTGTTGGGG - Intronic
954916736 3:54154720-54154742 TGTGAGATAACATGGTGTGGTGG + Intronic
955704746 3:61716415-61716437 TGTGGGATAACAATCTGTTTTGG + Intronic
955763636 3:62317159-62317181 TGTGAGACACCAGGCTGTTGAGG - Intergenic
955894699 3:63686833-63686855 TGTAATAGAACAATCTGTTGAGG - Intergenic
956595067 3:70958414-70958436 AGTCAGAAAACATTCCGTTTTGG - Intronic
956969405 3:74504903-74504925 TGAGACAAAAAATTCTGTTTTGG - Intronic
958686856 3:97409197-97409219 GCTGAGAGAACATTCTGTTAAGG + Intronic
959115669 3:102175137-102175159 TGTGAGTAAACATCCTGATATGG - Intronic
959245357 3:103861472-103861494 TGTGAGACGTTATTCTGTTGTGG + Intergenic
960527514 3:118726624-118726646 TGTAAGAAAACCTTCTTATGTGG - Intergenic
961400841 3:126641340-126641362 TGTGAGGAAACATGGTGTTTTGG - Intronic
961967425 3:130919896-130919918 TGTGAGGTAATATTGTGTTGTGG + Intronic
963660804 3:148126583-148126605 AGGGAGAAAACATTCTGTAACGG + Intergenic
963971065 3:151429865-151429887 TGGGAGAAAATAATCTGGTGAGG - Intronic
965049758 3:163630607-163630629 TGTGAGAAAGCATTTCATTGTGG + Intergenic
965627646 3:170697751-170697773 TTTAAGAAAACAGTCTATTGGGG - Intronic
966825974 3:183965397-183965419 TGAGAGACAACATCCTGTTTGGG - Exonic
969824514 4:9746933-9746955 TGTGACAAAACCTTCTGTCATGG - Intergenic
969933700 4:10659578-10659600 GGTTAGAAAGGATTCTGTTGAGG - Intronic
970419726 4:15894287-15894309 GGTGAGAAGACACTGTGTTGTGG + Intergenic
970734022 4:19144450-19144472 TGTGAGATAATATTTTATTGTGG - Intergenic
970889980 4:21032472-21032494 TCAGAGCAAACATTCTTTTGAGG + Intronic
971682762 4:29722767-29722789 TGAGAGAAAATATTTAGTTGTGG - Intergenic
972086056 4:35217292-35217314 TGAGAGAGAAAATTCAGTTGTGG - Intergenic
972819763 4:42687241-42687263 TTTAAGAAAACATCCTGGTGGGG + Intergenic
973635577 4:52859226-52859248 TGTGAGAAAACACTTTGATAGGG - Intergenic
975362379 4:73485904-73485926 TGTGAGAAATTATGCTTTTGTGG - Exonic
977151232 4:93515039-93515061 TGTAAGAAAAACTTCTGTTAGGG - Intronic
978451937 4:108843857-108843879 TGTCAGAAAACATTCTTTAATGG + Intronic
978570964 4:110136873-110136895 TGTGATAAAACTTTCTTTTTGGG - Intronic
978648718 4:110974033-110974055 TTTGAGAAAAGCTTCTGTAGAGG + Intergenic
979011017 4:115368538-115368560 TGTGAGAATATATTTTATTGTGG - Intergenic
980141004 4:128917123-128917145 TGTGAGCACACATTTTATTGTGG - Intronic
981049057 4:140293179-140293201 TGTGAGAAAACATTCTGTTGGGG - Intronic
981079500 4:140624712-140624734 TGTGAGAAAGAATTCTGCGGAGG - Intronic
981262144 4:142733998-142734020 TATAGGAAAACATTCTGTTATGG + Intronic
981585475 4:146297079-146297101 TGGGAGAAGACATTCTGGTGAGG + Intronic
982297649 4:153846434-153846456 TGTTAGAAAACATTTACTTGTGG + Intergenic
982365014 4:154568351-154568373 TGTAAGACAACATTATGTTCAGG - Intronic
982582763 4:157200118-157200140 TGTGGGATAAAATTCTTTTGTGG + Intergenic
982662257 4:158221347-158221369 TGGGAGAAGACATTATGTTTTGG - Intronic
982779227 4:159473005-159473027 TGTAATAAAATATTTTGTTGTGG - Intergenic
985841602 5:2310004-2310026 TGTGAGAGCACATTCAGTTTGGG - Intergenic
986273626 5:6254951-6254973 TGTAAGAAATAATTCTGCTGGGG + Intergenic
986895996 5:12368927-12368949 TGAAAGAAAAGTTTCTGTTGAGG + Intergenic
988038997 5:25863702-25863724 TGTGAGGAAGCATTCTTGTGTGG + Intergenic
988097178 5:26631240-26631262 TGAGAATAAAAATTCTGTTGTGG + Intergenic
989069422 5:37495137-37495159 TGTGTGAATACATTTTGCTGGGG - Intronic
989831941 5:45931001-45931023 TCTGAGAAACCACTCTGTTATGG + Intergenic
989848442 5:46176366-46176388 TCTGAGAAACCACTTTGTTGTGG - Intergenic
991569422 5:68038643-68038665 TGTGACAAAGTATTGTGTTGGGG + Intergenic
992273384 5:75089205-75089227 TGTTGGACAACATTCTGGTGTGG - Intronic
994704891 5:103191453-103191475 TCTCAGAAAACATTCTGAAGAGG + Intronic
995143757 5:108763372-108763394 TGTGACAAAACAATGTGATGAGG + Intronic
996024148 5:118624989-118625011 AGAGAGAAAACATTTTGTTGTGG + Intergenic
997219276 5:132146375-132146397 TGTGAGAAAATATCTTATTGTGG - Intergenic
999743467 5:154574343-154574365 TGTGAGAAAAGGATCTGTTGAGG + Intergenic
999942323 5:156557261-156557283 TGAAAGAAAACATTCTGTGAAGG - Intronic
1000536788 5:162488324-162488346 CGTAAGAAAAAATTCTTTTGGGG - Intergenic
1000876000 5:166638988-166639010 TTCTAGAAAACATTCAGTTGTGG - Intergenic
1004528493 6:16431289-16431311 ATTGAGAGAACATTCTGCTGGGG + Intronic
1004794619 6:19067476-19067498 TATGAGAAAACAGTTTGTTTTGG - Intergenic
1005603532 6:27451850-27451872 TGTGGGAAAACCTTCAGTTATGG - Exonic
1007872219 6:45053462-45053484 TTTGAGAAAACAGTATGGTGAGG + Intronic
1008286995 6:49665418-49665440 TGTGAGAATGCTTTCTGATGGGG + Intergenic
1008907605 6:56696848-56696870 TGCGGGAAAAGATTCTGCTGAGG - Intronic
1009299170 6:61993075-61993097 TTTGAGAAAACATTCTGCAAAGG - Intronic
1009397061 6:63212015-63212037 TGACAGAACACATTCAGTTGGGG - Exonic
1009434495 6:63602311-63602333 TGAGATAAAAGATACTGTTGTGG + Intergenic
1009580673 6:65529292-65529314 TGTAAGTAACCACTCTGTTGAGG + Intronic
1010024793 6:71202556-71202578 TATGAGACAACATACTGTTATGG - Intergenic
1010026792 6:71228013-71228035 TGTGAGAAAACATAGTGGTGTGG - Intergenic
1011250246 6:85364177-85364199 TGTGAGAAAACAGTGTTTGGTGG + Intergenic
1011401450 6:86966512-86966534 TGTGAGAAAAGATCTTGCTGTGG - Intronic
1013573695 6:111456649-111456671 TCTGAGAAAAGATTGTTTTGGGG - Intronic
1013712991 6:112923416-112923438 TTTGAAAAAAAATTCTGCTGTGG + Intergenic
1016781198 6:147960740-147960762 TGTGAGAAAACATCATTTTCTGG + Intergenic
1018413211 6:163577244-163577266 TTTAACAAAGCATTCTGTTGAGG - Exonic
1020461049 7:8430487-8430509 TTTGAAAAAACATTCTTTTTTGG - Intergenic
1020482273 7:8676776-8676798 AGAGAGAAAACATACTGTTTGGG + Intronic
1020719873 7:11729100-11729122 TGTGAGTAAACTTTATGTGGAGG + Intronic
1021665390 7:22972274-22972296 TGACAGAAAACAATCTGTTCAGG + Intronic
1021932920 7:25599380-25599402 TGTGAGAAGCCATTCTGAGGTGG + Intergenic
1022326435 7:29336309-29336331 TGTGAGAAAACACGCCGTTGAGG + Intronic
1023352306 7:39332938-39332960 ATTGAGAAAACATTCTAATGTGG - Intronic
1023653879 7:42400333-42400355 TCTCAGAAAACATTCTGTTAGGG - Intergenic
1024803848 7:53112561-53112583 TGTGAGAAATAATTCTTTTAAGG - Intergenic
1025811496 7:64878495-64878517 GGTGAGAATACAATCTGGTGAGG + Intronic
1027813292 7:82933427-82933449 TTTGAGAAAACAGTTTGCTGTGG + Intronic
1028103550 7:86850466-86850488 TGTGTGACAACATTCTTCTGGGG - Exonic
1028362205 7:89982396-89982418 TGTAAGAAATAATTCTGATGTGG + Intergenic
1030279433 7:107756625-107756647 TGTGATAAAACATTATTTAGAGG + Intronic
1030582425 7:111374764-111374786 AGTGAGAAAACAAAGTGTTGAGG + Intronic
1031765115 7:125768497-125768519 TCTGAGAAAACAATGTTTTGGGG + Intergenic
1032106213 7:129033374-129033396 TGTGAGGTAATATTTTGTTGTGG - Intronic
1035815796 8:2538661-2538683 TTTCAGAAAACATTCAGTTCTGG - Intergenic
1036481285 8:9141837-9141859 TTTGAGAGAAGATTATGTTGTGG + Intronic
1036594705 8:10201100-10201122 TGTGAGACCATATTTTGTTGGGG + Intronic
1038241937 8:25818034-25818056 AGTGAGCAAACAGGCTGTTGGGG + Intergenic
1039874236 8:41572028-41572050 TCAGAGAAAACTTTCTGTTGGGG + Intergenic
1040986876 8:53305031-53305053 TATGACAACACATTCAGTTGGGG + Intergenic
1041460875 8:58109871-58109893 TGGGAGAAAACAGTTTATTGCGG + Intronic
1041656226 8:60353129-60353151 TTTGAGATAAGATTTTGTTGGGG - Intergenic
1042690745 8:71495686-71495708 TGTAAGACAACATTCTGTAGTGG + Intronic
1046261360 8:111772448-111772470 TGAGAGAAAACAGCCAGTTGTGG - Intergenic
1046396115 8:113641810-113641832 TTTAAGAAAACATTTTGTTGAGG - Intergenic
1048317051 8:133370178-133370200 TGTGAGCAAACATGTTATTGTGG - Intergenic
1048559025 8:135512813-135512835 TATGAAAATATATTCTGTTGTGG + Intronic
1050938940 9:11434711-11434733 TCTGTGATATCATTCTGTTGAGG - Intergenic
1051024446 9:12590159-12590181 TTTGAGAAAATTTTATGTTGGGG + Intergenic
1052244178 9:26313634-26313656 AGTGACAAAACATTTTGGTGTGG + Intergenic
1052502924 9:29316257-29316279 TTTGAGAAAACCTTCTTTGGAGG + Intergenic
1052560843 9:30080793-30080815 TGTAAGAAAATATTATTTTGGGG + Intergenic
1054162285 9:61682134-61682156 GGTGAGGATACAGTCTGTTGAGG - Intergenic
1055241155 9:74188110-74188132 TGCCAGAAAATATTCAGTTGGGG - Intergenic
1055521439 9:77084972-77084994 GGAGAAAAAACATTCTTTTGAGG + Intergenic
1056480822 9:87003941-87003963 GCTGAGTAAACATTCTGTTCAGG - Intergenic
1056801866 9:89697848-89697870 TCTGAGAAATGTTTCTGTTGTGG + Intergenic
1056845692 9:90035860-90035882 TGGGAGAAAGTCTTCTGTTGAGG + Intergenic
1056991728 9:91419546-91419568 TGTGAGAATACACTTTGTTGAGG + Intronic
1185939637 X:4301450-4301472 TTGGAGAAAAAATTATGTTGGGG - Intergenic
1186684487 X:11911329-11911351 GGTGAGAGGACATTCTGTTCAGG + Intergenic
1186978080 X:14929679-14929701 CCTGAGAATACATTGTGTTGAGG + Intergenic
1188097130 X:26037284-26037306 TATGAGAAACCATTCTCTTTTGG - Intergenic
1189996022 X:46638954-46638976 TATGAGCAAACATTTTGTTAAGG - Intronic
1191721419 X:64231633-64231655 AGTGAGAACACATTCTGTTATGG - Intergenic
1191792036 X:64981321-64981343 TGTGAGAACAGATTTTATTGGGG + Intronic
1193491017 X:82147400-82147422 TGTGAGATAATATCCTATTGTGG - Intergenic
1193793035 X:85840153-85840175 TGTGAGAAAAGCATCTGTTATGG - Intergenic
1194794602 X:98196001-98196023 TGTGAAGAAACATTCTCCTGGGG + Intergenic
1196859303 X:120012509-120012531 TGTGAGGGAATATTCTCTTGAGG - Intergenic
1197347588 X:125343838-125343860 TTTTAGAAAACATTTTGTTCAGG - Intergenic
1198014863 X:132599927-132599949 TGTGATAAAATATTCTGTTGTGG - Intergenic
1198078943 X:133220419-133220441 TGTGAGAAAACATAAATTTGGGG - Intergenic
1198711602 X:139510097-139510119 TGTCAGAATTCATTCTCTTGGGG - Intergenic
1198890053 X:141384198-141384220 GGTTTGAAAACATTTTGTTGAGG + Intergenic
1200035432 X:153325274-153325296 TGTGAGATGGCATTTTGTTGTGG + Intergenic
1200705581 Y:6439726-6439748 CGTGAGGATACATTCTGGTGAGG - Intergenic
1200913308 Y:8549872-8549894 TGTGAGGCTACAATCTGTTGAGG + Intergenic
1200921403 Y:8616656-8616678 GGTGAGAATACAATCTGGTGAGG + Intergenic
1200933533 Y:8718640-8718662 GGTGAGAATACATTCTGATGAGG - Intergenic
1200934442 Y:8725869-8725891 GGTGAGAATACAATCAGTTGAGG - Intergenic
1200935633 Y:8735877-8735899 TGTGAGGATACAATCTATTGAGG - Intergenic
1201028530 Y:9724982-9725004 CGTGAGGATACATTCTGGTGAGG + Intergenic