ID: 981049058

View in Genome Browser
Species Human (GRCh38)
Location 4:140293180-140293202
Sequence ATGTGAGAAAACATTCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981049058_981049063 14 Left 981049058 4:140293180-140293202 CCCAACAGAATGTTTTCTCACAT 0: 1
1: 0
2: 0
3: 23
4: 378
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049058_981049062 7 Left 981049058 4:140293180-140293202 CCCAACAGAATGTTTTCTCACAT 0: 1
1: 0
2: 0
3: 23
4: 378
Right 981049062 4:140293210-140293232 TAAACAACTGGGCTGCCACTAGG No data
981049058_981049060 -5 Left 981049058 4:140293180-140293202 CCCAACAGAATGTTTTCTCACAT 0: 1
1: 0
2: 0
3: 23
4: 378
Right 981049060 4:140293198-140293220 CACATGAAATCTTAAACAACTGG 0: 1
1: 1
2: 0
3: 13
4: 211
981049058_981049061 -4 Left 981049058 4:140293180-140293202 CCCAACAGAATGTTTTCTCACAT 0: 1
1: 0
2: 0
3: 23
4: 378
Right 981049061 4:140293199-140293221 ACATGAAATCTTAAACAACTGGG 0: 1
1: 0
2: 2
3: 15
4: 283
981049058_981049064 15 Left 981049058 4:140293180-140293202 CCCAACAGAATGTTTTCTCACAT 0: 1
1: 0
2: 0
3: 23
4: 378
Right 981049064 4:140293218-140293240 TGGGCTGCCACTAGGTGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981049058 Original CRISPR ATGTGAGAAAACATTCTGTT GGG (reversed) Intronic
902971416 1:20054951-20054973 GTCTAATAAAACATTCTGTTGGG - Intronic
903254057 1:22080323-22080345 ATTTAAGAAAATAATCTGTTTGG + Intronic
906807139 1:48790003-48790025 CTGTCAGAAAACATTCACTTAGG + Intronic
906813661 1:48854756-48854778 AAGTGATAAAAAATTCTGCTAGG + Intronic
906840954 1:49138726-49138748 ATTTGAGAAACCATTCCTTTTGG - Intronic
906997530 1:50812975-50812997 AAGTGAGAACACACTATGTTTGG - Intronic
907929474 1:58985949-58985971 ATGTGAGAAAAGACTTTGATGGG - Intergenic
909168415 1:72259107-72259129 AGGTCATAAAACATTTTGTTTGG - Intronic
910372060 1:86526520-86526542 ATGTGAGAACATATAGTGTTTGG - Intergenic
910558860 1:88567874-88567896 ATGTGCTAAGGCATTCTGTTGGG - Intergenic
910798375 1:91120775-91120797 TTATGAGAAAACATTGGGTTGGG + Intergenic
911033686 1:93516257-93516279 AAGTGAGAAAACATCCTGGAAGG + Intronic
911760233 1:101605566-101605588 TTGTGAGAGAACAGTCTGATAGG + Intergenic
911885941 1:103299584-103299606 ATGAGAGAACACATTCCCTTTGG + Intergenic
911978646 1:104536836-104536858 ATTTGAGAAAACAATTTATTGGG + Intergenic
912601745 1:110942240-110942262 ATATGGCAATACATTCTGTTGGG - Intergenic
916955535 1:169829638-169829660 ATTTGAGAAAACATTTTGGGTGG + Intronic
918372886 1:183879485-183879507 ATGTGCTAAAAAATTCTTTTTGG + Intronic
919182956 1:194109325-194109347 ATGTTTGAAAAAATTCTTTTTGG + Intergenic
919361095 1:196595922-196595944 AAGTGAGAACACATGATGTTTGG + Intronic
919565248 1:199177027-199177049 ATTTGAGAAATCATAATGTTCGG - Intergenic
920405621 1:205707488-205707510 AAGTGAGAGAACATTCATTTTGG - Intergenic
921621154 1:217327888-217327910 ATGTGAGAAAACAATACCTTTGG + Intergenic
922171857 1:223162176-223162198 AGGTGCCAAAAGATTCTGTTTGG - Intergenic
922390122 1:225132452-225132474 AAGTGAGAAAATATGGTGTTTGG + Intronic
924001475 1:239557719-239557741 AAGTGAGAACACATGGTGTTTGG + Intronic
924366129 1:243295758-243295780 AAGAGAGAAAACATGCTATTCGG - Intronic
924553035 1:245096088-245096110 ATCTGAAAAAACAATCTGTGAGG - Intronic
1063725965 10:8637853-8637875 CTGGGAGAAAACATACTGTGTGG + Intergenic
1065125859 10:22573666-22573688 ATGTTGGAAAAAAATCTGTTTGG - Intronic
1065680564 10:28227210-28227232 ATTTGGGAAAACCTTCTTTTTGG - Intronic
1066513101 10:36123365-36123387 GAGTGAGAACACATGCTGTTTGG + Intergenic
1068139641 10:52989852-52989874 ATGTGAATTCACATTCTGTTAGG + Intergenic
1068145635 10:53067063-53067085 AAGTGAGAAAATATGATGTTTGG - Intergenic
1068573667 10:58659490-58659512 AAGTGAGAATACATGGTGTTTGG - Intronic
1069074819 10:64027936-64027958 AAGTGAGAACACATGGTGTTTGG - Intergenic
1070685842 10:78480209-78480231 ATTTTAGAACACATGCTGTTAGG + Intergenic
1070709823 10:78672709-78672731 AAGTGAGAACACATGGTGTTTGG - Intergenic
1071173522 10:82896991-82897013 ATGAGAGAAGAAATTCGGTTTGG + Intronic
1072135905 10:92545730-92545752 ATCTCAGAAAATCTTCTGTTGGG - Intronic
1072244354 10:93528776-93528798 ATAAGAGAAAACATTGTGTGTGG - Exonic
1072518102 10:96206353-96206375 ATGTTAAAAAAAATTGTGTTTGG - Intronic
1072593723 10:96851872-96851894 ACGTGAGAAAATAATGTGTTTGG - Intronic
1073022779 10:100460316-100460338 GTGTGAGAACACATGGTGTTTGG - Intergenic
1073874772 10:107909764-107909786 GAGTGTGAAAACATTATGTTGGG - Intergenic
1073965251 10:108981484-108981506 ATGTGGGAAAACATTCTGACAGG - Intergenic
1075628483 10:123983883-123983905 AAGTGAGAATACATGATGTTTGG - Intergenic
1076048049 10:127310646-127310668 ATATGAGAAATCATTCTTTATGG - Intronic
1078398806 11:11005321-11005343 ATGAGAGAAATCATTATGTATGG + Intergenic
1078562695 11:12387180-12387202 ATGTGTAAACACATTCTGTTAGG + Intronic
1080489966 11:32751614-32751636 ATGTGGAAAAACAATCTGTGCGG - Intronic
1080954299 11:37075174-37075196 ATGTCAGAAGACATTCTGCATGG - Intergenic
1081463675 11:43296431-43296453 ATGGGAGCAAACATACAGTTGGG + Intergenic
1082294928 11:50428970-50428992 ATCTGAGAAACCACTCTGTGAGG + Intergenic
1083060870 11:59869816-59869838 AAGTGAGAAAATATTTTTTTTGG - Intergenic
1085834778 11:79941222-79941244 ATGTGAAAAAACATTTTGGAAGG + Intergenic
1086141137 11:83501756-83501778 ATGTGAGTGAAAATTCTGTCTGG + Intronic
1086375502 11:86195820-86195842 ATGTGAGAAATAACTCTGTCTGG + Intergenic
1086563229 11:88192973-88192995 AAGTGAGAACACATGCTATTTGG + Intergenic
1086756906 11:90576183-90576205 AAATGAGAGAACATTCAGTTTGG - Intergenic
1088089222 11:106018704-106018726 ATTTGACATAACATTCTCTTGGG - Intronic
1090148574 11:124356804-124356826 ATATGAGAAAACATTTCTTTTGG - Intergenic
1092057074 12:5516497-5516519 AAGTGAGAACACAGTCTGCTCGG - Intronic
1095642811 12:44504180-44504202 CTTTGAGAAAAGATTCTATTTGG - Intergenic
1095901081 12:47328642-47328664 AAGTGAGAACACATGGTGTTTGG + Intergenic
1096772869 12:53947337-53947359 ATCTGAGATAACATTGTTTTAGG - Intergenic
1096896141 12:54822008-54822030 ATGTGAGAAAACATGAGTTTTGG + Intergenic
1098253429 12:68592100-68592122 ATGTGAGAAACCATTCTCCAAGG - Intergenic
1098301443 12:69058202-69058224 CTGTCAGAAAGTATTCTGTTGGG - Intergenic
1099098490 12:78405783-78405805 AGGTGACAAAACATCCTATTTGG - Intergenic
1099404968 12:82248287-82248309 ATGTGAGAAAACATTTTGAGTGG - Intronic
1100002644 12:89856054-89856076 ATTTTAGAAAATATTATGTTTGG - Intergenic
1100096081 12:91038803-91038825 ATGTGAGAACACATTCCCTGTGG + Intergenic
1101045776 12:100804184-100804206 AAGTGAGAACACATGGTGTTTGG + Intronic
1101046113 12:100807788-100807810 AAGTGAGAACACATGATGTTTGG + Intronic
1101313337 12:103605130-103605152 ATGTGAAAAATTATTCTATTTGG - Intronic
1101375581 12:104168530-104168552 ATGTGAGAAAACATTTTAAATGG + Intergenic
1103285872 12:119801143-119801165 ATCTTATTAAACATTCTGTTGGG + Intronic
1104086853 12:125483275-125483297 ATGTGAGAAAAAATAGTGATTGG + Intronic
1104553834 12:129781861-129781883 ATATGAGAAAAGATCCTGTTTGG + Intronic
1106026634 13:25961292-25961314 ATTTAAGACAACATCCTGTTCGG + Intronic
1107944831 13:45408658-45408680 TTGTTTAAAAACATTCTGTTCGG - Intronic
1108102556 13:46972449-46972471 ATGTGAAAAAACATTCTCATTGG + Intergenic
1108183007 13:47860127-47860149 AAGTTTGATAACATTCTGTTAGG + Intergenic
1108279501 13:48847304-48847326 CAATGAGAAAACATTCTGTTGGG - Intergenic
1108564267 13:51679690-51679712 ATGAGAGAAAAACTGCTGTTTGG - Intronic
1108962447 13:56251650-56251672 ATGAGAGAAAACATACATTTTGG - Intergenic
1109095779 13:58114668-58114690 ATGTTAGAAAATATGCAGTTAGG + Intergenic
1109332432 13:60946027-60946049 ATGTGAGAATACATACACTTTGG + Intergenic
1109547279 13:63845018-63845040 GAGTGAGAAAACATTGTGTTTGG - Intergenic
1110907584 13:80911901-80911923 ATGAGTGAAAACATAGTGTTTGG + Intergenic
1111521226 13:89407174-89407196 AAGTCAGAAAAGATTATGTTAGG - Intergenic
1112615027 13:100995617-100995639 AAGTGAGAACACATGGTGTTTGG + Intergenic
1112922816 13:104636422-104636444 ATGAGAGAAAACACTCTCTATGG + Intergenic
1113580161 13:111422995-111423017 TTGTAGGAAAAAATTCTGTTTGG - Intergenic
1115351762 14:32403088-32403110 ATGTGAGAAAACCCTCTTCTTGG - Intronic
1115887461 14:37989060-37989082 AGGTGATAAAACTATCTGTTGGG - Intronic
1116244343 14:42389928-42389950 ATGTGAGAATAGATTGTGATGGG + Intergenic
1116741415 14:48759984-48760006 ATGTGAGAACATATGATGTTTGG - Intergenic
1117118514 14:52542114-52542136 ATGTTATAAACCATTCTATTGGG - Intronic
1117170962 14:53095006-53095028 CTGTGATAGGACATTCTGTTTGG - Intronic
1117335472 14:54753902-54753924 AATTGAGAAACCATTCTCTTTGG + Intronic
1117543419 14:56770662-56770684 ATGGAAGAATACATTCTGTAGGG + Intergenic
1119878791 14:78083057-78083079 CTGTGGGAAAACATCCTCTTAGG + Intergenic
1120282362 14:82455311-82455333 ATGTGGGAAAACTTTCTAGTAGG + Intergenic
1120293825 14:82612701-82612723 ATGTGTCATTACATTCTGTTTGG - Intergenic
1120378040 14:83734252-83734274 ATGAGCGAAAAAATTCTGTAAGG + Intergenic
1122395780 14:101428999-101429021 ATGAGTGAGAACATGCTGTTTGG + Intergenic
1122766020 14:104070771-104070793 AATGGAGAAAACATTCTGTGTGG + Intergenic
1123956742 15:25343947-25343969 ATTTAACAACACATTCTGTTTGG + Intronic
1124187530 15:27543043-27543065 ATGTCAGAAAACCCTCTTTTAGG - Intergenic
1124467923 15:29956071-29956093 AGTTAAGAAAACATTCTGGTTGG + Intronic
1125334688 15:38615784-38615806 TAGTTAGAAAAGATTCTGTTTGG + Intergenic
1125916499 15:43492800-43492822 ATTTTAGAAAACATTCTTTTGGG - Intronic
1127762113 15:62149737-62149759 ATGTCAGAAAGCATAATGTTAGG + Intergenic
1129082031 15:73050225-73050247 ATCTGAGAAAAGATTTTCTTAGG - Intergenic
1129143823 15:73629570-73629592 ATTTTAGAAACCATTTTGTTTGG - Intronic
1130455883 15:84106860-84106882 ATCTGAAAAAACATTTTGCTAGG + Intergenic
1130780103 15:87027790-87027812 AAGTGAGAACACATGGTGTTTGG - Intronic
1130824362 15:87528995-87529017 ACATGAGCAAACATTCTGTAGGG - Intergenic
1130979049 15:88800346-88800368 ACGTGATAAACCTTTCTGTTTGG - Intergenic
1131097384 15:89665149-89665171 ATGTGTCAAAACCTTCTGTCTGG + Exonic
1131101205 15:89691219-89691241 AAGTGAGAAAATGTTCTGCTTGG + Intronic
1131633337 15:94203274-94203296 ATGTGAGAAAACATTTTAAATGG + Intergenic
1134516447 16:14891144-14891166 ATTTGACAAAATACTCTGTTGGG - Intronic
1134704120 16:16289796-16289818 ATTTGACAAAATACTCTGTTGGG - Intronic
1134728435 16:16440029-16440051 ATGTAAGTAAAGACTCTGTTTGG + Intergenic
1134963423 16:18422318-18422340 ATTTGACAAAATACTCTGTTGGG + Intronic
1134967718 16:18504917-18504939 ATTTGACAAAATACTCTGTTGGG + Intronic
1135284753 16:21183860-21183882 ATGTGAGAACATATGGTGTTTGG - Intergenic
1135885001 16:26297651-26297673 ATGTGAGAGGACGTTTTGTTTGG + Intergenic
1135954649 16:26946053-26946075 ATATGTCAAAACATCCTGTTAGG - Intergenic
1137396781 16:48121737-48121759 GTGAGAGAAAACATACTCTTTGG - Exonic
1138202175 16:55097495-55097517 AAGTGAGAACACATGATGTTTGG + Intergenic
1138841820 16:60518278-60518300 ATGTGAGATAAATTTCTTTTAGG - Intergenic
1141039879 16:80664050-80664072 ATGTGGCAAAATATTCTGTAGGG + Intronic
1143210338 17:5182024-5182046 ATGTGAGAAAACCTTCAGCAAGG - Exonic
1143210401 17:5182603-5182625 ATGTGAGAAAACCTTCAGCCAGG - Exonic
1143210461 17:5183179-5183201 ATGTGAGAAAACCTTCAGCAAGG - Exonic
1144438146 17:15259615-15259637 CTGTGAGAAATAATTATGTTGGG - Intronic
1144806325 17:17970635-17970657 AGGTGGGAAAACACTCTTTTGGG + Intronic
1144993372 17:19249431-19249453 ATGTGATTAAACAGTCTCTTGGG + Intronic
1146381088 17:32328043-32328065 AAGTGAGAAGACACACTGTTAGG + Intronic
1147807674 17:43143785-43143807 ATTTCAGAAAACATACTGGTGGG - Intergenic
1149022862 17:51990396-51990418 ATTTTAGCAAAAATTCTGTTTGG - Intronic
1149417021 17:56470021-56470043 AAGTGAGAACACATAGTGTTTGG + Intronic
1149965751 17:61162381-61162403 ATATGAAACAACCTTCTGTTGGG - Intronic
1154389750 18:13926198-13926220 AGGTGAGAAAAGATGCTGGTGGG + Intergenic
1155126036 18:22876569-22876591 ATGTGGTAATACATTCTGTGAGG - Intronic
1155379173 18:25199508-25199530 ATGTGGGTAAACATTCTTTTTGG + Intronic
1155918875 18:31583069-31583091 GTGTGAGAAAACTTTCTGGATGG + Intergenic
1156145977 18:34178827-34178849 ATGTGATAAACCAACCTGTTTGG + Intronic
1156719545 18:40053028-40053050 ATTTGAGAACAAATTTTGTTTGG + Intergenic
1157457420 18:47846287-47846309 AGGTGAGAAAAAATTCTACTGGG + Intronic
1158149334 18:54349737-54349759 AGGTGAGAAAAGATGATGTTTGG + Intronic
1158684325 18:59599354-59599376 AGTTGAGAAAACATGCAGTTTGG + Intronic
1159354932 18:67326656-67326678 CTGTGATAAAACATACTATTAGG - Intergenic
1160007458 18:75078139-75078161 ATTTGACAAAAATTTCTGTTAGG - Intergenic
1160206579 18:76838980-76839002 ACGTAAGAAAACAATCTGTATGG - Intronic
1162227901 19:9239638-9239660 TTGTGAGAAAACAACCTGATTGG - Intergenic
1165961839 19:39541237-39541259 ATGTGAGAAAACATTTTAAATGG - Intergenic
1166402275 19:42492118-42492140 ATGTGAGAAAAGATCTTGTATGG - Intergenic
925173279 2:1765820-1765842 ATGAGTGAGAACATGCTGTTTGG - Intergenic
925569481 2:5293824-5293846 ATCTTAGAAATCATTCAGTTTGG + Intergenic
928806768 2:35167456-35167478 ATGTGAAAATACTTTCTGTTTGG - Intergenic
930220139 2:48738171-48738193 AAGAGAAAAAACATTCTGGTAGG - Intronic
932262563 2:70338936-70338958 ATGTAAGAAAAAATACTGTCTGG - Intergenic
933750316 2:85598973-85598995 TTTTGAGAAAGTATTCTGTTGGG - Exonic
935486104 2:103656190-103656212 ATTTGAGGAAATTTTCTGTTTGG - Intergenic
935934221 2:108164483-108164505 TTGTGAGAAGACATGCTATTTGG - Intergenic
936465324 2:112743442-112743464 ATCTCAAAAAACATTGTGTTTGG - Intronic
937391037 2:121486695-121486717 GTATGAGAGAACATTCTGGTAGG - Intronic
937516247 2:122659087-122659109 ATGAGTGAAAACATTTTGTTTGG + Intergenic
937664785 2:124473567-124473589 ATATAAGAAGACATTCTGATTGG + Intronic
938923600 2:136018378-136018400 TTATTAGAAACCATTCTGTTGGG - Intergenic
939052541 2:137325394-137325416 CTGTGTGATACCATTCTGTTGGG - Intronic
939192122 2:138929369-138929391 CTGTGAGCTAACATTGTGTTAGG - Intergenic
939682441 2:145155223-145155245 ATGTGAAAGAATAATCTGTTAGG + Intergenic
940029130 2:149241850-149241872 AAGTGAGAACATATTATGTTTGG - Intergenic
940057918 2:149532887-149532909 AGATAGGAAAACATTCTGTTTGG - Intergenic
940529593 2:154864067-154864089 ATATGAGAAAACAATCTAATAGG - Intergenic
941215239 2:162698905-162698927 ATGTGGGAAAATATTTTCTTTGG + Intronic
941555338 2:166972490-166972512 ATGAGAAAAAATATTCTGTAAGG + Intronic
941804688 2:169699248-169699270 AAGTGAGAACACATGGTGTTTGG + Intronic
941904300 2:170706257-170706279 ATGTGATAAATCTTTCTTTTAGG - Intergenic
941962527 2:171268178-171268200 TTGTGACAAACCATTCTCTTGGG + Intergenic
942570359 2:177308006-177308028 ATGTAAGAAAACTTACTGTGGGG - Intronic
944119819 2:196228979-196229001 GTGTAAGAAAAGATTGTGTTAGG + Intronic
944131822 2:196354981-196355003 ATGTAGTAAAACATTCAGTTTGG - Intronic
944167325 2:196736743-196736765 AAGTGAGAACACATGGTGTTTGG + Intronic
946945774 2:224820492-224820514 GTGTGAGTAAACATGCTGCTTGG + Intronic
948788042 2:240363257-240363279 TTTTGGGAAAACATTTTGTTTGG - Intergenic
1169977410 20:11345635-11345657 ATTTGAGAGAGGATTCTGTTTGG - Intergenic
1170162541 20:13328713-13328735 AAGTGAGAACACATGGTGTTTGG - Intergenic
1171399542 20:24863646-24863668 ATTTGAGATGACATTTTGTTGGG - Intergenic
1173095895 20:40027871-40027893 AAGTGAGAACACATGATGTTTGG + Intergenic
1175609065 20:60334991-60335013 GTGGGAGAAAGCATTCTGATTGG + Intergenic
1176695730 21:9975394-9975416 GTGTGAGAAAGCTTTATGTTGGG + Intergenic
1176890564 21:14312992-14313014 TTGCAAGAAAACATTCTCTTTGG + Intergenic
1177548618 21:22592549-22592571 AAGTGAGAACACATGATGTTTGG + Intergenic
1177752271 21:25298967-25298989 ATGTGTGAAAGCATTGTGTCTGG + Intergenic
1178154562 21:29836260-29836282 ATGAGAAATAACATTCTCTTGGG + Intronic
1178191359 21:30285251-30285273 ATGGAAGAAAACATTATTTTAGG - Intergenic
1178934501 21:36850119-36850141 TTTTCAGAAAACATTCTGTGTGG + Intronic
1179360101 21:40698199-40698221 ATGTGAGAAAACATTTTAAATGG + Intronic
1180028497 21:45184031-45184053 ATGTAATAAAACGTTCTATTTGG - Intronic
1184049769 22:41995855-41995877 ATGTGAGACAACCTTTTATTGGG + Intronic
949743921 3:7266612-7266634 AAAAGAGAAAACATTTTGTTTGG - Intronic
951938675 3:28052849-28052871 ATGTGAGAGCACATTCTTTTTGG - Intergenic
952323616 3:32300656-32300678 ATGTTATAAAATATTCTTTTAGG + Intronic
952722063 3:36544056-36544078 AGGTGAGAAAACACACTCTTTGG + Intronic
952806267 3:37356073-37356095 TTGTAAGAAAACAATCTGTTAGG - Intronic
955627638 3:60935692-60935714 ATCTGAGAAAATATTTTGTTTGG - Intronic
956129799 3:66042216-66042238 ATTTGGCAATACATTCTGTTGGG + Intergenic
957584520 3:82116432-82116454 ATGCGACAAAACATTGTATTAGG - Intergenic
957635948 3:82785403-82785425 AAGTGAGAAAATATACAGTTGGG - Intergenic
958672988 3:97228397-97228419 ATGTGAGAACATATGATGTTTGG + Intronic
959545047 3:107585838-107585860 ATGTAAGAAAACAAGCTATTTGG + Intronic
959725316 3:109535391-109535413 ATGGGATAAAACATGCTGATCGG - Intergenic
959735560 3:109654126-109654148 GAGTGAGAAAACATGGTGTTTGG - Intergenic
960378637 3:116933188-116933210 ATGTGAGAAAACACTGCCTTAGG - Intronic
961418431 3:126779981-126780003 ATGTGAGAGAATATTCCTTTTGG + Intronic
961515923 3:127435729-127435751 ATGTTTTAAAATATTCTGTTGGG - Intergenic
963570230 3:146984685-146984707 ATGACAGAAAACATTTAGTTTGG - Intergenic
964907778 3:161738994-161739016 ATGTGATAAAACAGTCTTTTTGG + Intergenic
965073127 3:163941285-163941307 GTGTGAGAACACATGGTGTTTGG + Intergenic
965653291 3:170955826-170955848 AAGTGAGAACACATGGTGTTTGG + Intergenic
966078665 3:175971239-175971261 AAGTGAGAAAACAATTTGATGGG + Intergenic
966437369 3:179903841-179903863 AACTTACAAAACATTCTGTTGGG - Intronic
966825975 3:183965398-183965420 CTGAGAGACAACATCCTGTTTGG - Exonic
967150407 3:186643554-186643576 AAGCGAGCAAACATTTTGTTAGG + Intronic
967940927 3:194765979-194766001 AAGTGAGAACACATGCTATTTGG - Intergenic
970717578 4:18944553-18944575 AAGTGAGAAAACAATGAGTTCGG - Intergenic
970804830 4:20018509-20018531 ATGGGAGAAAACATTTCCTTAGG + Intergenic
970931254 4:21515006-21515028 ATGTAAGAACATATTATGTTAGG - Intronic
971554520 4:27996681-27996703 AAGTGAGAACACATGATGTTTGG + Intergenic
971700509 4:29967660-29967682 ATGAAATAATACATTCTGTTAGG - Intergenic
971762309 4:30782307-30782329 ATGTGAGGAAACATAATGTAAGG + Intronic
972819762 4:42687240-42687262 ATTTAAGAAAACATCCTGGTGGG + Intergenic
973635578 4:52859227-52859249 GTGTGAGAAAACACTTTGATAGG - Intergenic
973925664 4:55735114-55735136 ATGTGAGAACACATGGTATTTGG - Intergenic
974401156 4:61408784-61408806 AAGTGAGAAAACACTGAGTTTGG + Intronic
974612128 4:64230527-64230549 ATGTGAGGACACATTTTCTTAGG - Intergenic
974982587 4:68978261-68978283 ATGTGTATAAACATTCTTTTAGG + Intergenic
975951465 4:79777197-79777219 ATGTGAGAACATATAATGTTTGG - Intergenic
976019145 4:80598799-80598821 ATCTGAGGAAACAGTATGTTAGG - Intronic
976164260 4:82237430-82237452 AAGTGAGAAAACGTGATGTTTGG - Intergenic
976510887 4:85908829-85908851 ATCTGAGAAAGCTTTTTGTTAGG - Intronic
976800100 4:88980326-88980348 TTGTTTGAAAACATTTTGTTTGG + Intronic
977151233 4:93515040-93515062 GTGTAAGAAAAACTTCTGTTAGG - Intronic
977178117 4:93839767-93839789 ATGTGAGAAAACTTTGTATGGGG - Intergenic
977430224 4:96922845-96922867 ATGAGAGAGAACATTGTCTTTGG - Intergenic
978570965 4:110136874-110136896 CTGTGATAAAACTTTCTTTTTGG - Intronic
979282150 4:118880205-118880227 ATGTGAAAAATTATTCTGTCTGG + Intronic
979911717 4:126375497-126375519 GTGGGAAAAAACATTCTGTAAGG - Intergenic
980198677 4:129625806-129625828 ATTTGAGAAACAATTCTGATAGG - Intergenic
980368349 4:131835627-131835649 GTGTGAGAAAGCTTTATGTTGGG + Intergenic
981049058 4:140293180-140293202 ATGTGAGAAAACATTCTGTTGGG - Intronic
981064196 4:140463864-140463886 ATATGAGAAAATATTCTTCTGGG + Intronic
981558047 4:146016682-146016704 ATGTGAGAAGACATTGAATTGGG - Intergenic
982352338 4:154429467-154429489 TTGTGTGGAAACATTTTGTTTGG - Intronic
982501049 4:156155189-156155211 CAGTGAGAAAACATTTTATTAGG + Intergenic
983717544 4:170803700-170803722 AAATGAGAAAACACTCAGTTTGG - Intergenic
985841603 5:2310005-2310027 ATGTGAGAGCACATTCAGTTTGG - Intergenic
985900523 5:2786078-2786100 ATTTGAGAATACATTCTGTAGGG + Intergenic
986273625 5:6254950-6254972 ATGTAAGAAATAATTCTGCTGGG + Intergenic
987985168 5:25136534-25136556 ATGTGAGATAACATTCATCTGGG + Intergenic
988359968 5:30224001-30224023 ATATCAGAGAACATTTTGTTTGG - Intergenic
988846573 5:35133712-35133734 AGGAGAGAAAACATGCTGTGAGG - Intronic
989338428 5:40347541-40347563 ATGGGTTAAAACACTCTGTTAGG + Intergenic
989351051 5:40487116-40487138 ATGTGACCACACATTCAGTTAGG - Intergenic
989849491 5:46191416-46191438 ATATGAGAAAACACTTTGTGAGG + Intergenic
990721635 5:58702355-58702377 ATGAAAGAAAACAGCCTGTTTGG - Intronic
991001319 5:61786208-61786230 AAGTGAGAACACATGATGTTTGG - Intergenic
991317549 5:65326463-65326485 CTGTGAGATAACATTTTCTTTGG - Intronic
992131533 5:73697806-73697828 ATGTGTGAAAACATGTTGTAGGG - Intronic
992530548 5:77647820-77647842 GTGTGAAAAAAAATTCTGCTGGG - Intergenic
992630262 5:78673046-78673068 TAGTGAGAAAACATGATGTTTGG + Intronic
993272562 5:85813745-85813767 ATGTGAAACAATATTGTGTTGGG - Intergenic
993712247 5:91237255-91237277 ATGTGAACAAACATTGTGTTAGG + Intergenic
994020143 5:95013854-95013876 ATTTAAGAATACATTCTGTAAGG + Intronic
994834026 5:104825490-104825512 ATGTAAGAAAAGATTCTTGTGGG + Intergenic
995255062 5:110036479-110036501 AAGTGAGAACACATGGTGTTTGG - Intergenic
997003572 5:129791766-129791788 GAGTGAGAAAACATCATGTTTGG + Intergenic
997057523 5:130461680-130461702 ATATGAGAAAACATTAGGTCAGG + Intergenic
997800412 5:136855116-136855138 ATGACACAAAACCTTCTGTTTGG - Intergenic
997911037 5:137873664-137873686 ATTTTAAAAAACATTTTGTTTGG + Intronic
999818893 5:155204501-155204523 ATGTGAGAAAACATTTTAAATGG - Intergenic
1000536789 5:162488325-162488347 ACGTAAGAAAAAATTCTTTTGGG - Intergenic
1000886788 5:166756842-166756864 ATTTGAGAAATCATTTTGTGAGG + Intergenic
1004100486 6:12604878-12604900 GTGTTAGAAGACATTGTGTTTGG - Intergenic
1004528492 6:16431288-16431310 AATTGAGAGAACATTCTGCTGGG + Intronic
1004712698 6:18187561-18187583 ATGTCAGAAAGAATTCTGTCTGG + Intronic
1005247581 6:23906010-23906032 AAGTGAGAACACACTGTGTTTGG + Intergenic
1006550545 6:34819469-34819491 ATGTGGGCCAGCATTCTGTTGGG + Intronic
1006813618 6:36836830-36836852 AGGTGAGAAAACAGTCTGGGTGG - Intronic
1008069196 6:47082393-47082415 AAGTGACAATACATTCTGTTGGG - Intergenic
1009260001 6:61473891-61473913 ATCTGAGAAACCATTTTGTGAGG + Intergenic
1009518505 6:64651824-64651846 ATAAGAGAAAACATTGAGTTAGG - Intronic
1010370578 6:75102498-75102520 ATCTGAGAAAACATTTGATTTGG + Intronic
1011314886 6:86020497-86020519 ATATGTGACCACATTCTGTTAGG + Intergenic
1011877734 6:91982220-91982242 GTGTGCTAAAACATTCTGTCTGG - Intergenic
1013573696 6:111456650-111456672 ATCTGAGAAAAGATTGTTTTGGG - Intronic
1014921505 6:127219275-127219297 AAGTGATAAAATATTCTGGTTGG - Intergenic
1016890116 6:148997529-148997551 ATATTAGAGAACATTCTGTAAGG - Intronic
1017688473 6:156938147-156938169 ATGTGTAAAAACTTTCTGTATGG + Intronic
1017735811 6:157362133-157362155 ATCTGAGGAAACATATTGTTTGG + Intergenic
1017982645 6:159414871-159414893 GTGTGAGAAAACACTCTGTAGGG + Intergenic
1018270537 6:162072499-162072521 ATCTGAGAAATCATCTTGTTTGG - Intronic
1018284013 6:162217936-162217958 GTGTGGGAAAACATTCTGGCAGG + Intronic
1019213920 6:170428826-170428848 ATGAGAGATAACATTGTGTGAGG + Intergenic
1020482272 7:8676775-8676797 CAGAGAGAAAACATACTGTTTGG + Intronic
1020531738 7:9346562-9346584 AGGTAAGAAAGCATTCTTTTTGG + Intergenic
1021255783 7:18390785-18390807 AGATTAGAAAACATTGTGTTTGG + Intronic
1021521963 7:21547760-21547782 TTGTGAGAAAACATTTTATACGG - Intronic
1022246834 7:28568591-28568613 ATGTGGGAAAACACTATGATTGG - Intronic
1023341586 7:39227218-39227240 ATGTGAGAAATCTTACTTTTAGG + Intronic
1023653880 7:42400334-42400356 GTCTCAGAAAACATTCTGTTAGG - Intergenic
1024436766 7:49365744-49365766 CTGTGAGAGAAAACTCTGTTAGG + Intergenic
1027645626 7:80794436-80794458 ATGTTTGAAAACATTCAGTTAGG - Intronic
1028040349 7:86044613-86044635 ATGTGAGAACACACTGTATTTGG + Intergenic
1028101409 7:86825193-86825215 AAGTGAGAACACATGGTGTTTGG + Intronic
1028496837 7:91470892-91470914 AAGTGAGAACATATACTGTTTGG + Intergenic
1029032312 7:97481487-97481509 ATTTGAAAAAACAATGTGTTTGG + Intergenic
1029878896 7:103784760-103784782 AACTCAGAAAACATTCTTTTTGG + Intronic
1030683658 7:112460060-112460082 ATGACAGAAAACACTCTGCTGGG + Intronic
1031765114 7:125768496-125768518 ATCTGAGAAAACAATGTTTTGGG + Intergenic
1032604635 7:133336494-133336516 AAATGAAAACACATTCTGTTGGG - Intronic
1033504795 7:141989035-141989057 CTGTGAGAAATCATTTTGATAGG + Intronic
1033785435 7:144724613-144724635 ATGTGACAAAACATTTTTTCAGG - Intronic
1034348485 7:150401536-150401558 ATGTGAGAACACACTGTTTTTGG - Intronic
1034722558 7:153308090-153308112 GAGTGAGAAAACATGGTGTTTGG - Intergenic
1035559485 8:593919-593941 ATGTGAGCAAACATTGTGAGGGG + Intergenic
1039874235 8:41572027-41572049 ATCAGAGAAAACTTTCTGTTGGG + Intergenic
1040057977 8:43077271-43077293 ATGTGAGAAATAACTCTGTCTGG + Exonic
1040822592 8:51580808-51580830 ATGTGAGAAATAACTCTGGTTGG + Intronic
1040883559 8:52234872-52234894 ATGTGAGAACATATAATGTTTGG - Intronic
1041675659 8:60536743-60536765 AAGTGAGGTAACATTCTTTTTGG + Intronic
1041764988 8:61409781-61409803 GTGTAAGGAAACATTCTATTGGG - Intronic
1041881355 8:62754040-62754062 ATGTGTAAAAACATTTTTTTGGG - Intronic
1042059513 8:64801603-64801625 ATGTGATAAAATAATATGTTTGG - Intergenic
1043157266 8:76799378-76799400 AGGTGAGAAAATATAATGTTTGG - Intronic
1043567052 8:81560083-81560105 TGGTGAGAAACTATTCTGTTGGG - Intergenic
1043861342 8:85320701-85320723 CTGTGAGAAAACATAATGATGGG + Intergenic
1044169678 8:89034102-89034124 AAGTGAGAACACATGCTATTTGG - Intergenic
1046233707 8:111393034-111393056 ATATGAGAAAAAATTCTGGATGG - Intergenic
1046595866 8:116260441-116260463 ATGTGAGAAAAGCTGCTGGTGGG - Intergenic
1047013473 8:120697844-120697866 ATATTACTAAACATTCTGTTTGG - Intronic
1047547455 8:125832940-125832962 ATGAGAGATGACATTCTGGTTGG + Intergenic
1049111288 8:140645665-140645687 GTGTTAGAAAACATTCTTCTGGG + Intergenic
1049945016 9:585962-585984 ATGTAAGAAAACGTTAGGTTTGG + Intronic
1050161664 9:2726098-2726120 ATGTGACAACTCATTCTGTGAGG + Intronic
1050435264 9:5602015-5602037 ATGTCAAAATATATTCTGTTTGG + Intergenic
1050818906 9:9853330-9853352 ATGTCATAAAACATTCTTCTTGG + Intronic
1050941801 9:11470426-11470448 AAGTGAGAAGACGTTGTGTTTGG - Intergenic
1050969966 9:11857822-11857844 ATTTAAGAAAACATTGTTTTAGG + Intergenic
1051534895 9:18145666-18145688 ATATGAGAAAACCTTGAGTTTGG + Intergenic
1051612330 9:18973129-18973151 TTTTGAGAACAGATTCTGTTGGG - Intronic
1052234889 9:26199172-26199194 ATGAGAGAAAAATTTCTTTTGGG + Intergenic
1052962355 9:34309693-34309715 ATTTCTGAAAACATTTTGTTTGG - Intronic
1053466317 9:38311317-38311339 ATGTGAGGAAAGCTTCTGGTGGG - Intergenic
1053632713 9:39961351-39961373 GTGTGAGAAAGCTTTATGTTGGG + Intergenic
1053773045 9:41502182-41502204 GTGTGAGAAAGCTTTATGTTGGG - Intergenic
1054211175 9:62289346-62289368 GTGTGAGAAAGCTTTATGTTGGG - Intergenic
1054313806 9:63559499-63559521 GTGTGAGAAAGCTTTATGTTGGG + Intergenic
1055908348 9:81319078-81319100 TTGTGAGCAAACATTTTGCTGGG + Intergenic
1056984527 9:91350066-91350088 ATGTGAAAACACATTATGTATGG + Intronic
1058247968 9:102654397-102654419 ATTTGAGAATCCATTATGTTTGG + Intergenic
1058556238 9:106170661-106170683 AAGTGAGAACACATGGTGTTTGG - Intergenic
1058751382 9:108041594-108041616 ATGTTAGGTAACCTTCTGTTAGG - Intergenic
1058869251 9:109188398-109188420 CTGTTGGACAACATTCTGTTTGG - Intronic
1059071370 9:111140660-111140682 ATGTCAGAAAATATCCTTTTAGG - Intergenic
1059568367 9:115407350-115407372 ATGTGTTAAAACATCCTCTTGGG - Intergenic
1187190098 X:17026262-17026284 ATGTGAGTATAAAATCTGTTTGG + Intronic
1188360501 X:29247003-29247025 ATGTGAAAAAATAGTTTGTTAGG + Intronic
1189367077 X:40397121-40397143 ATGAGAGAGAATATTCTGATGGG + Intergenic
1189425063 X:40892453-40892475 AAGTGAGAACACATGATGTTTGG - Intergenic
1189674535 X:43447751-43447773 TTGTGATAAAACGTTCTGTATGG + Intergenic
1190963267 X:55273204-55273226 ATGTGAGAAAAGATCTTGTATGG + Intronic
1191730440 X:64328873-64328895 ATGAGAAAACACATTCTGTGTGG - Exonic
1191836031 X:65463024-65463046 GTGTGAGAACACATACTCTTTGG - Intronic
1192758681 X:74072232-74072254 ATGAGTGAAAACATGGTGTTTGG + Intergenic
1193054033 X:77130829-77130851 ATGTGAGAACATACTATGTTTGG - Intergenic
1193072989 X:77326231-77326253 ATGGGTGAAAACATGCAGTTAGG + Intergenic
1193353303 X:80486603-80486625 ATGCAAGCAAACATGCTGTTTGG + Intergenic
1193616743 X:83697862-83697884 ATGTGAGAAAATACGATGTTGGG + Intergenic
1194032549 X:88834513-88834535 ATGTGAGAACATATGATGTTTGG - Intergenic
1194794601 X:98196000-98196022 ATGTGAAGAAACATTCTCCTGGG + Intergenic
1194994525 X:100577225-100577247 ATGTGAGAAAACATTTTAAATGG - Intergenic
1195715511 X:107814493-107814515 AAGTGAGAACACGTTGTGTTTGG - Intergenic
1195792400 X:108602445-108602467 TTGTGAGAATAAATTCTGTGAGG - Intronic
1197692007 X:129512026-129512048 CTGTAAGGAAACATTTTGTTAGG + Intronic
1197907198 X:131438201-131438223 AAGTGAGAACACATGGTGTTTGG - Intergenic
1198033765 X:132781073-132781095 ATGTGAGAAACCTTACAGTTAGG - Intronic
1198078944 X:133220420-133220442 ATGTGAGAAAACATAAATTTGGG - Intergenic
1198361295 X:135897908-135897930 AAGTGAGAACACGTGCTGTTTGG + Intronic
1199009367 X:142740593-142740615 ATGTGAGGACACCTACTGTTAGG - Intergenic
1199221499 X:145321384-145321406 GAGTGAGAACACATGCTGTTTGG + Intergenic
1200850442 Y:7877628-7877650 ATGTTACAAAGCTTTCTGTTGGG + Intergenic
1201312296 Y:12607722-12607744 GTGTGAGAAATCATTCTTATAGG + Intergenic
1201715650 Y:17042271-17042293 ATGTGAGAATATATGATGTTTGG - Intergenic
1202603607 Y:26619505-26619527 ATCAGATAAAACATTCTGTATGG - Intergenic