ID: 981049059

View in Genome Browser
Species Human (GRCh38)
Location 4:140293181-140293203
Sequence CATGTGAGAAAACATTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 489}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981049059_981049064 14 Left 981049059 4:140293181-140293203 CCAACAGAATGTTTTCTCACATG 0: 1
1: 0
2: 2
3: 34
4: 489
Right 981049064 4:140293218-140293240 TGGGCTGCCACTAGGTGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 181
981049059_981049060 -6 Left 981049059 4:140293181-140293203 CCAACAGAATGTTTTCTCACATG 0: 1
1: 0
2: 2
3: 34
4: 489
Right 981049060 4:140293198-140293220 CACATGAAATCTTAAACAACTGG 0: 1
1: 1
2: 0
3: 13
4: 211
981049059_981049063 13 Left 981049059 4:140293181-140293203 CCAACAGAATGTTTTCTCACATG 0: 1
1: 0
2: 2
3: 34
4: 489
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049059_981049061 -5 Left 981049059 4:140293181-140293203 CCAACAGAATGTTTTCTCACATG 0: 1
1: 0
2: 2
3: 34
4: 489
Right 981049061 4:140293199-140293221 ACATGAAATCTTAAACAACTGGG 0: 1
1: 0
2: 2
3: 15
4: 283
981049059_981049062 6 Left 981049059 4:140293181-140293203 CCAACAGAATGTTTTCTCACATG 0: 1
1: 0
2: 2
3: 34
4: 489
Right 981049062 4:140293210-140293232 TAAACAACTGGGCTGCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981049059 Original CRISPR CATGTGAGAAAACATTCTGT TGG (reversed) Intronic
903112563 1:21148916-21148938 CATTTCAAAAAACATTCTGAAGG - Intronic
904817055 1:33211818-33211840 CAAGTTAGAAAACATTCTTCAGG - Intergenic
905759924 1:40547063-40547085 AATGTGGGAAAACATTCACTTGG + Exonic
906605533 1:47167459-47167481 CAAGTTGGAAAACATTCTGCAGG + Intergenic
907958273 1:59252356-59252378 CAAGTGGGAAAACACTCTGCAGG + Intergenic
908621514 1:65986289-65986311 CATATCACAAAACATTCTGAGGG + Intronic
908898242 1:68924909-68924931 CAAGTTGGAAAACATTCTGCAGG + Intergenic
909370565 1:74878547-74878569 CAAGTTGGAAAACACTCTGTAGG + Intergenic
909376009 1:74943033-74943055 CATGTCAGAGAATATGCTGTAGG + Intergenic
911217819 1:95215270-95215292 CAAGTTAGAAAACACTCTTTGGG - Intronic
911555888 1:99343989-99344011 GATGTGGGAAACCATTCTGTAGG - Intergenic
911652447 1:100405011-100405033 CATGTGAATATACATACTGTAGG + Intronic
912636332 1:111297133-111297155 CATGTTGGAAAACACTCTGCAGG + Intronic
912646305 1:111395294-111395316 CAAGTTAGAAAACACTCTGTAGG + Intergenic
913299593 1:117357147-117357169 CAAGTTGGAAAACATTCTGCAGG - Intergenic
913337521 1:117722223-117722245 CAAGTTGGAAAACATTCTGCAGG + Intergenic
913534998 1:119763371-119763393 GATGTGAAAAAACAGTATGTTGG - Intronic
915614544 1:157026878-157026900 CATGTGAGAAAACAAACGGGTGG + Intronic
916903489 1:169256147-169256169 CAAGTTGGAAAACACTCTGTAGG - Intronic
916985786 1:170190395-170190417 CAAGTGGGAAAACATACTTTAGG - Intergenic
917091896 1:171361098-171361120 CAAGTTAGAAAACATTCTTCAGG + Intergenic
917182632 1:172315796-172315818 CAAGTTAGAAAACATTCTGCAGG + Intronic
917194076 1:172447995-172448017 GAAGGGAGAAGACATTCTGTGGG + Intronic
917202846 1:172535095-172535117 AAGGTGAGAAAACATACTGAGGG - Intronic
918096491 1:181340155-181340177 CATGTAAAAAAAAATTATGTAGG - Intergenic
918382620 1:183971562-183971584 CTTGGGAGAAAACATTATATTGG - Intronic
918468619 1:184847032-184847054 CAAGTTGGAAAACATTCTGCAGG + Intronic
919873274 1:201840382-201840404 AATATGATAACACATTCTGTTGG + Intronic
920428836 1:205900983-205901005 CAAGTGAGAAAACACTCTTCAGG + Intergenic
922118847 1:222642708-222642730 CATTTGACAACACACTCTGTAGG - Intronic
922691688 1:227697434-227697456 AATGTAGGAAAACATTCTGCCGG - Intergenic
923007398 1:230062063-230062085 AGTTTGACAAAACATTCTGTTGG - Intronic
1064438387 10:15331187-15331209 TGTGTGTGAAAACATGCTGTAGG - Intronic
1065107717 10:22407721-22407743 CAAGTTGGAAAACATTCTGCAGG - Intronic
1065157712 10:22887190-22887212 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1066168689 10:32817395-32817417 CAAGTTGGAAAACACTCTGTAGG + Intronic
1066214289 10:33270869-33270891 CATGGAAGAAAACATTAGGTTGG + Intronic
1066751399 10:38660738-38660760 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1067364555 10:45613029-45613051 ACTGTGAGAAAAATTTCTGTAGG + Intergenic
1068272508 10:54747338-54747360 CATGTCACAAAACATTTTGTAGG - Intronic
1068356949 10:55922084-55922106 CAAGTTAGAAAACACTCTTTAGG - Intergenic
1068688025 10:59889265-59889287 CACGTGAGAAAGCATTCTATGGG + Intronic
1069735410 10:70650710-70650732 CATGCTAGAATACATTCTGGGGG + Intergenic
1070311771 10:75279006-75279028 CATGTCTGAAAGCATTCTGCTGG + Intergenic
1071072559 10:81711033-81711055 CATGTTGGAAAACACTCTGCAGG + Intergenic
1071868600 10:89766085-89766107 CAAGTTGGAAAACATTCTGCAGG - Intronic
1073022378 10:100456000-100456022 CAAGTTGGAAAACATTCTTTAGG + Intergenic
1073647717 10:105323190-105323212 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1074348568 10:112712623-112712645 CATGTAAGCAAAGATTCTTTAGG - Intronic
1075885085 10:125893069-125893091 CATATGAGATAAAATTCTATAGG + Intronic
1078242669 11:9544921-9544943 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1078560551 11:12367500-12367522 CAAGTTAGAAAACATTCTTCAGG + Intergenic
1079957612 11:26883771-26883793 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1080291403 11:30675146-30675168 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1081172169 11:39882443-39882465 CAAGTCAGAAAACACTCTGCAGG + Intergenic
1081427582 11:42941749-42941771 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1082269125 11:50150397-50150419 CAAGTGAGAAAACACTCTGCAGG + Intergenic
1082314114 11:50695988-50696010 CAAGTGGGAAAACACTCTGCAGG + Intergenic
1082629064 11:55519793-55519815 CAAGTTAGAAAACACTCTGCAGG - Intergenic
1082648998 11:55763510-55763532 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1085580098 11:77642862-77642884 CATGTGAGAGTACTTTCTCTTGG + Intergenic
1085604324 11:77883607-77883629 CATGAGAGATAAGATTCTGTTGG - Intronic
1086254357 11:84856940-84856962 CTTGTGACAAAACATACTTTTGG - Intronic
1086977541 11:93152922-93152944 CAAATGAAAAAACATTCAGTAGG - Intronic
1087003306 11:93443626-93443648 CAAGTTAGAAAACATTCTTCAGG - Intergenic
1087248999 11:95875179-95875201 CAAGTTGGAAAACATTCTGCAGG - Intronic
1087396824 11:97610407-97610429 CAGGGGAGAAAAAGTTCTGTTGG + Intergenic
1087859856 11:103140788-103140810 CAAGTTGGAAAACATTCTGCAGG - Intronic
1088089223 11:106018705-106018727 CATTTGACATAACATTCTCTTGG - Intronic
1088798328 11:113283445-113283467 CATGTAATAAAAGATTCTGAGGG + Intergenic
1090865977 11:130700882-130700904 CATGTGAGAAAGCACTGTCTAGG + Intronic
1091185416 11:133642218-133642240 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1091243892 11:134075199-134075221 CATTTGGGTAAATATTCTGTGGG + Intronic
1093579501 12:20770501-20770523 CAAGTCGGAAAACATTCTGCAGG + Intergenic
1094387571 12:29911444-29911466 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1094431392 12:30373840-30373862 CATGTGGGAATACTTTCTCTTGG - Intergenic
1095159443 12:38899758-38899780 TATTTAAGAAATCATTCTGTGGG - Intronic
1096012627 12:48233742-48233764 TATCTGAGAAAACATTCTTCTGG - Intergenic
1096685191 12:53283796-53283818 CCTGTGGGAAAACATTCTTAGGG - Intronic
1097321497 12:58231523-58231545 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1097543577 12:60970818-60970840 TATGTGATAAAACTTCCTGTGGG - Intergenic
1097606972 12:61767591-61767613 TGTGTGAGAAAAGATTTTGTTGG - Intronic
1097930854 12:65184221-65184243 TTTGTGAGAAAATATTCTCTAGG - Intronic
1098057461 12:66523087-66523109 CAAGTGGGAAAACACTCTGCAGG + Intronic
1099538295 12:83872504-83872526 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1099773906 12:87099824-87099846 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1100154679 12:91784084-91784106 CATCTCAGAAAACCTTTTGTGGG - Intergenic
1100563971 12:95776719-95776741 CAGGTAAGAAAACACTCTGCAGG + Intronic
1100902859 12:99263043-99263065 TATGTGAGGGAACATTGTGTGGG - Intronic
1102656457 12:114485936-114485958 CATGTGAGAAAGAATTTTGATGG + Intergenic
1103682417 12:122704970-122704992 AAAGGGAGAAAACATTCTATAGG - Intergenic
1103684147 12:122718417-122718439 AAAGGGAGAAAACATTCTATAGG - Intergenic
1104244547 12:127025128-127025150 CATGTGAGAAAGCATTGAGGTGG - Intergenic
1105036374 12:132926003-132926025 AATGTGGGAAAACCTTCTTTGGG - Exonic
1105046862 12:133011420-133011442 AATGTGGGAAATCCTTCTGTTGG + Exonic
1105066490 12:133204205-133204227 AATGTGAGAAATCCTTCAGTGGG + Intergenic
1105244093 13:18632411-18632433 CAAGTTAGAAAACATTCTTCAGG + Intergenic
1106867811 13:33986087-33986109 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1106966868 13:35081599-35081621 CATTTGAGAAAACAGTTTGGAGG + Intronic
1106980344 13:35271914-35271936 CAAGTTAGAAAACATTCTTCAGG + Intronic
1107489644 13:40869158-40869180 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1108279502 13:48847305-48847327 TCAATGAGAAAACATTCTGTTGG - Intergenic
1108549384 13:51527942-51527964 CAAGGTAGAAAACATTCTGCAGG + Intergenic
1108829714 13:54462455-54462477 CATTTTACAAAACATCCTGTTGG + Intergenic
1109817025 13:67598454-67598476 GATTTCAGAAAACATACTGTGGG - Intergenic
1111474499 13:88726593-88726615 CTTATGAGAAAACTTTCTGTTGG + Intergenic
1111845701 13:93506220-93506242 CACCTTAGAATACATTCTGTGGG - Intronic
1112015205 13:95325762-95325784 CATGTGATATAACATGCAGTGGG - Intergenic
1112653744 13:101426275-101426297 CATTTGAGAAAACCTGCTGGTGG + Intergenic
1114983078 14:28189861-28189883 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1115107343 14:29776702-29776724 CAAGTTGGAAAACACTCTGTAGG + Intronic
1115158351 14:30364958-30364980 CAAGTGGGAAAACACTCTGCAGG + Intergenic
1115401741 14:32969283-32969305 AATGTCAGACCACATTCTGTTGG + Intronic
1115469165 14:33749961-33749983 CAAGAGAGAAAAGATTCTTTGGG - Intronic
1116078876 14:40147401-40147423 CATGTGAGAAAATAAACTCTGGG + Intergenic
1117115254 14:52504128-52504150 CAAGTTAGAAAACACTCTGCAGG + Intronic
1117300777 14:54424798-54424820 CATGTGAGAGACCATTATCTGGG + Exonic
1117543418 14:56770661-56770683 CATGGAAGAATACATTCTGTAGG + Intergenic
1117585663 14:57200425-57200447 CATGTGAGAAAGGAGTCTCTGGG - Intergenic
1118204673 14:63711537-63711559 CAAGTCTGAAACCATTCTGTTGG + Intronic
1118425187 14:65652841-65652863 CATCTGAGAGCACATTCTCTTGG + Intronic
1119060613 14:71470455-71470477 CTTGTAAGAAATCATTCTGCAGG - Intronic
1120322318 14:82979885-82979907 CATGAGAGAAATTCTTCTGTTGG + Intergenic
1120670668 14:87359308-87359330 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1120692658 14:87610512-87610534 TGTATGAGAACACATTCTGTTGG + Intergenic
1202872958 14_GL000225v1_random:180885-180907 CATATGAGATAAAATTCTATAGG - Intergenic
1125218595 15:37307860-37307882 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1125916500 15:43492801-43492823 GATTTTAGAAAACATTCTTTTGG - Intronic
1126167384 15:45665347-45665369 CATGTGAGAAATCATCCTGCTGG + Intronic
1126516667 15:49546840-49546862 CAAGTTAGAAAACACTCTGCAGG + Intronic
1126661284 15:51036209-51036231 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1126966116 15:54056518-54056540 CAAGTTGGAAAACATTCTGCAGG + Intronic
1129132464 15:73513028-73513050 CAAGTTGGAAAACACTCTGTAGG - Intronic
1129919716 15:79310109-79310131 AATGTGTGAAAGCAATCTGTAGG - Intergenic
1129962816 15:79703466-79703488 CATGTAATAAAAAATTCTGAAGG + Intergenic
1130058331 15:80549690-80549712 AATGTGACAGCACATTCTGTTGG + Intronic
1130631977 15:85578848-85578870 CCTCTGAGCAAAAATTCTGTTGG - Intronic
1130824363 15:87528996-87529018 CACATGAGCAAACATTCTGTAGG - Intergenic
1131907939 15:97164464-97164486 CATCTGAGAAAGAATTCGGTAGG - Intergenic
1131928940 15:97417894-97417916 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1132338197 15:101062196-101062218 CATGTGAGACAGCATGCTTTAGG - Intronic
1133451458 16:5907211-5907233 TATGTGAGAAATCATGCAGTTGG + Intergenic
1134146234 16:11765400-11765422 CATGTGATAAAACATTCACTTGG - Intronic
1134705671 16:16301260-16301282 CAGGTTAGAAAACATTTTCTAGG - Intergenic
1134793082 16:17008815-17008837 CAAGTTGGAAAACATTCTTTAGG - Intergenic
1134961870 16:18410854-18410876 CAGGTTAGAAAACATTTTCTAGG + Intergenic
1134966168 16:18493453-18493475 CAGGTTAGAAAACATTTTCTAGG + Intronic
1134976446 16:18574511-18574533 CATTTTGGAAAACATTCGGTTGG + Intergenic
1135169607 16:20171781-20171803 CATATGAAAAAATATTCTATAGG - Intergenic
1136647450 16:31634451-31634473 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1137304413 16:47184186-47184208 CAAGTTGGAAAACATTCTGCAGG + Intronic
1137360690 16:47812560-47812582 CAAGTTAGAAAACATTCTGCAGG - Intergenic
1137461372 16:48667231-48667253 CAAGTTAGAAAACATTCTTCAGG - Intergenic
1137699109 16:50483249-50483271 CACGTGAGCAAAGATTCTTTGGG - Intergenic
1139626101 16:68189417-68189439 CATGGGAAAAAAGATTGTGTTGG + Intronic
1140060872 16:71568597-71568619 CAAATGAGAAGACATTTTGTTGG + Intronic
1141039878 16:80664049-80664071 TATGTGGCAAAATATTCTGTAGG + Intronic
1141876668 16:86829577-86829599 CTTGTAAGAAAACAACCTGTAGG - Intergenic
1143468472 17:7155381-7155403 TATGGTGGAAAACATTCTGTGGG - Intergenic
1145404764 17:22578299-22578321 TATGTGAGGAAACATTGAGTTGG + Intergenic
1148628274 17:49087145-49087167 CAGGAGGGAAAACATGCTGTGGG + Intergenic
1149604286 17:57913920-57913942 CATGTGAGAAGACTTTCTGGAGG - Intronic
1149965752 17:61162382-61162404 CATATGAAACAACCTTCTGTTGG - Intronic
1150921925 17:69492933-69492955 CATGAGAAAAATCATTCAGTTGG + Intronic
1151113869 17:71710728-71710750 CATGTAAAGAATCATTCTGTAGG + Intergenic
1153368832 18:4290305-4290327 CAAGTGAGAATGCATTCTGCAGG + Intronic
1154364210 18:13691314-13691336 CAAGTGGGAAAACATTCTTCAGG + Intronic
1154389749 18:13926197-13926219 CAGGTGAGAAAAGATGCTGGTGG + Intergenic
1154392520 18:13952430-13952452 AAAGTGAGAAAACATTTTGGAGG - Intergenic
1154444849 18:14427490-14427512 CAAGTTAGAAAACATTCTTCAGG - Intergenic
1155620552 18:27773654-27773676 CATGTGAGCCAACATTATGTTGG - Intergenic
1155897890 18:31352553-31352575 CAAGTTGGAAAACACTCTGTAGG - Intronic
1156843203 18:41633163-41633185 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1157058113 18:44254845-44254867 CAAGTTAGAAAACATTCTTCAGG - Intergenic
1157631938 18:49106989-49107011 CAAGTTGGAAAACATTCTGCAGG - Intronic
1158262906 18:55628607-55628629 CATTGGAAAACACATTCTGTAGG + Intronic
1158825705 18:61216360-61216382 CATGTGAGAATATGTTCTTTTGG + Intergenic
1158912792 18:62084172-62084194 CTTATGAGAAAAGATTATGTTGG + Intronic
1159654940 18:71022106-71022128 CAGGTGAGAAGACAATCTCTAGG - Intergenic
1160171136 18:76556263-76556285 TTTGTGAGAAAACATTTTGGAGG - Intergenic
1160391687 18:78538931-78538953 CATGTGGGAAAACATTTTCATGG - Intergenic
1160485573 18:79289198-79289220 CAAGTTGGAAAACATTCTGCAGG - Intronic
1161185611 19:2917556-2917578 AGTGTGGGAAAACATTCAGTTGG + Exonic
1162686590 19:12390769-12390791 AATGTGGGAAAGCATTCTCTTGG - Exonic
1162690922 19:12430459-12430481 AATGTGGGAAAGCATTCTCTTGG - Exonic
1164242570 19:23402765-23402787 TATGTGACAATGCATTCTGTGGG + Intergenic
1164244487 19:23418546-23418568 CATGTCAGAAACCATGATGTTGG - Intergenic
1164452804 19:28381305-28381327 CAGGTGGGAAAACAGCCTGTGGG + Intergenic
1165003613 19:32786506-32786528 CAAGTTAGAAAACATTCTTCAGG - Intronic
925700673 2:6634286-6634308 AATGGGAGAAAACATTTTCTGGG + Intergenic
926658915 2:15441064-15441086 CAAGTTGGAAAACATTCTGCAGG + Intronic
927525712 2:23738107-23738129 CAAGTTGGAAAACACTCTGTAGG + Intergenic
928852673 2:35767993-35768015 CAAGTTGGAAAACACTCTGTAGG + Intergenic
929381569 2:41360019-41360041 CAAGTTAGAAAACACTCTGCAGG + Intergenic
931889456 2:66655153-66655175 CATGTGAGCACACATTCAGTTGG - Intergenic
932027207 2:68146768-68146790 CATGTTAGAAAACATGATGCAGG + Intronic
932520364 2:72405260-72405282 CAAGTCAGAAAACACTCTGCAGG + Intronic
933202572 2:79467435-79467457 CAAGTTAGAAAACACTCTGCAGG + Intronic
933238531 2:79893215-79893237 CATGTGAGAAAACGGGCTGAAGG - Intronic
933251545 2:80034753-80034775 AATTTGATAAAACATTCTGTTGG + Intronic
933594027 2:84263908-84263930 CAAGTTGGAAAACATTCTGCAGG + Intergenic
934484597 2:94693069-94693091 CATGTGAGAAAATCTTTCGTGGG - Intergenic
936024580 2:109021563-109021585 CATGTCAGAACTCATTCTGAGGG - Intergenic
936448170 2:112613566-112613588 CAAGTTAGAAAACACTCTGCAGG - Intergenic
937240554 2:120459577-120459599 CATTGGAGGAGACATTCTGTAGG - Intergenic
937689635 2:124740639-124740661 CACGTGAAAATAAATTCTGTAGG - Intronic
938429646 2:131221342-131221364 CAAGTGAGAAAAAAATCAGTTGG + Intronic
939052542 2:137325395-137325417 CCTGTGTGATACCATTCTGTTGG - Intronic
939102940 2:137916307-137916329 CATCTGAGAACAAAATCTGTCGG + Intergenic
939157528 2:138543318-138543340 CAAGTGGGAAAACACTCTGCAGG - Intronic
939529936 2:143345920-143345942 TATATGAGAAATCCTTCTGTGGG + Intronic
939807368 2:146789945-146789967 CAAGTTGGAAAACATTCTGCAGG + Intergenic
940095308 2:149967266-149967288 CAAGTTGGAAAACACTCTGTAGG + Intergenic
940111543 2:150160341-150160363 CATGTGCCAAATTATTCTGTAGG - Intergenic
940347946 2:152646599-152646621 CAGTGGAGCAAACATTCTGTGGG + Intronic
941121628 2:161537085-161537107 CAAGTTGGAAAACATTCTGCAGG + Intronic
942570360 2:177308007-177308029 AATGTAAGAAAACTTACTGTGGG - Intronic
943031243 2:182688086-182688108 CAAGTTGGAAAACATTCTGCAGG + Intergenic
943860117 2:192850787-192850809 CATATGAGATAACCTTCTATTGG + Intergenic
944466286 2:200003107-200003129 CATGTTAGTTAACATTCTTTTGG - Intronic
945161720 2:206898798-206898820 CAAGTGAGAAAACACTCTTCAGG - Intergenic
945343418 2:208684939-208684961 CAAGTTAGAAAACAATCTGCAGG - Intronic
945349601 2:208761680-208761702 CAAGTTGGAAAACACTCTGTAGG + Intronic
945590472 2:211722972-211722994 CCTGTAAGAAAACATTGTGATGG + Intronic
947996857 2:234535123-234535145 CATGTGAGAAAAAATAGTGTGGG - Intergenic
948078072 2:235182180-235182202 CATGTGTGTGGACATTCTGTGGG + Intergenic
1170483490 20:16792421-16792443 CAAGTTAGAAAACACTCTGCAGG - Intergenic
1170619547 20:17983516-17983538 CATTTGAGAAAACATCATGGAGG - Intronic
1171569548 20:26235101-26235123 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1173186703 20:40845809-40845831 CATGTGTGGAAAGATGCTGTGGG + Intergenic
1173532533 20:43781441-43781463 GATGTGAAATAACATTCTGTGGG + Intergenic
1174682891 20:52424857-52424879 CATTTGAGAAAAGTTTCTGGAGG + Intergenic
1175660986 20:60811927-60811949 CATGTAAGAAAAGATTTTGAAGG - Intergenic
1177574222 21:22929953-22929975 CAAGTGGGAAAACGTTCTCTAGG - Intergenic
1177720810 21:24904340-24904362 TATGTAAGTGAACATTCTGTAGG + Intergenic
1178154561 21:29836259-29836281 CATGAGAAATAACATTCTCTTGG + Intronic
1178765588 21:35447962-35447984 CATGTGAAAAAACATTCATAGGG - Intronic
1179305612 21:40151460-40151482 CAAGTGAGATTTCATTCTGTAGG - Intronic
1180743456 22:18070482-18070504 TACCTGAGAAAACCTTCTGTGGG - Intergenic
1181001647 22:19990526-19990548 CAAGTGGGAAAACAATCAGTGGG - Intronic
1181800307 22:25343444-25343466 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1181904419 22:26182666-26182688 CCATAGAGAAAACATTCTGTGGG + Intronic
1182169334 22:28210697-28210719 CAAGTTGGAAAACACTCTGTAGG + Intronic
1182769694 22:32785620-32785642 AATCTGAGAAAACACTCTCTGGG - Intronic
1183193822 22:36339408-36339430 CTGGTGGAAAAACATTCTGTGGG - Intronic
1184049768 22:41995854-41995876 CATGTGAGACAACCTTTTATTGG + Intronic
951226384 3:20126042-20126064 GGTGGGAGAAAACGTTCTGTAGG - Exonic
951389362 3:22083640-22083662 CAAGTTGGAAAACACTCTGTAGG + Intronic
951833645 3:26958252-26958274 CAAGTTAGAAAACACTCTTTAGG - Intergenic
951861849 3:27262415-27262437 CAAGTTGGAAAACACTCTGTGGG - Intronic
952104327 3:30051671-30051693 CAAGTGGGAAAACACTCTGCAGG + Intergenic
952630176 3:35455986-35456008 CAAGTTAGAAAACACTCTGCAGG + Intergenic
952632102 3:35481949-35481971 CAAGTTAGAAAACACTCTGCAGG - Intergenic
953514879 3:43580206-43580228 CATGTGGGAAAACATTTTGATGG - Intronic
953575363 3:44109043-44109065 GATGTGAGGAAGCATTCTGGGGG - Intergenic
953689310 3:45104404-45104426 CACATATGAAAACATTCTGTAGG - Intronic
955193536 3:56784268-56784290 GATGTGAGAAAACATCCTCCGGG - Intronic
956030330 3:65030372-65030394 CTTGTGAAAACACAATCTGTTGG + Intergenic
956207514 3:66770090-66770112 CAAGTGGGAAAACATTCTTCAGG - Intergenic
956394610 3:68811732-68811754 CAAGTTGGAAAACATTCTGCAGG + Intronic
957438282 3:80208867-80208889 CATGATAGTAAACGTTCTGTGGG + Intergenic
958253077 3:91292677-91292699 CAAGTTGGAAAACACTCTGTGGG + Intergenic
958423169 3:93951153-93951175 CAAGTGGGAAAACATTCTTCAGG + Intronic
959091652 3:101910030-101910052 CAAGTTAGAAAACATTCTTCAGG - Intergenic
959172331 3:102858316-102858338 CATCTGAGAAAATTTTCTTTTGG + Intergenic
959522433 3:107335261-107335283 CAAGTGGGAAAACACTCTGCAGG + Intergenic
960840036 3:121948331-121948353 GATCAGAGAACACATTCTGTTGG + Intergenic
962231784 3:133672416-133672438 CGTGAGAGAAATCATTCTGCAGG - Intergenic
962907482 3:139817813-139817835 CAAGTTGGAAAACATTCTGCAGG - Intergenic
963253725 3:143123121-143123143 CATGTGAGAAAACATCCCCCAGG - Intergenic
963435088 3:145257205-145257227 CAAGTTGGAAAACATTCTGCAGG - Intergenic
963484554 3:145919446-145919468 CAAGTTGGAAAACATTCTGCAGG + Intergenic
963912385 3:150825878-150825900 CATGCTTGAAAACATTCTGAGGG - Intergenic
964192601 3:154021830-154021852 CATGTGAGGAAACTTCCTATGGG + Intergenic
964535575 3:157717472-157717494 CATCTGAGAAAACACTTTGAAGG - Intergenic
964639420 3:158892800-158892822 CAGGTAACAAAATATTCTGTGGG - Intergenic
964790306 3:160448614-160448636 CTTTTGAAAAAACATTGTGTTGG - Intronic
965221538 3:165932662-165932684 CAAGTTAGAAAACATTCTTCAGG + Intergenic
965650675 3:170929513-170929535 CAAGTTGGAAAACACTCTGTAGG - Intergenic
965886267 3:173450645-173450667 CAAGTTGGAAAACATTCTGCAGG - Intronic
966005856 3:175011193-175011215 CATGTTAGAAGCCCTTCTGTGGG - Intronic
966432844 3:179850720-179850742 AATGTATGAAAACATTCTTTGGG - Intronic
967639578 3:191845570-191845592 CATGTTCAAAAACTTTCTGTTGG + Intergenic
967640057 3:191851603-191851625 CATGTTCAAAAACTTTCTGTTGG - Intergenic
969807294 4:9619151-9619173 CAAGTTGGAAAACACTCTGTAGG + Intergenic
970689076 4:18601709-18601731 CAAGTTAGAAAACACTCTGCAGG - Intergenic
970791000 4:19857557-19857579 CATGTGAGAAAGAATTTTCTGGG + Intergenic
971684184 4:29743556-29743578 CATGTGAGAACACAATCAGAAGG + Intergenic
971686945 4:29782742-29782764 CATGCTAGTAAACATTATGTGGG - Intergenic
971814179 4:31465730-31465752 CATGTGGGAATACTTTCTCTTGG - Intergenic
971993199 4:33928577-33928599 CATGTGAGAACACAATCAGAAGG + Intergenic
971998825 4:34002070-34002092 TATGTGAGTAAACATTGAGTTGG - Intergenic
972416843 4:38848837-38848859 CATGTTGGAAAACATTCTGCAGG + Intronic
973055497 4:45652728-45652750 CAAGTTGGAAAACACTCTGTAGG + Intergenic
974201068 4:58641298-58641320 CATGTGAGCAAAGATTTTGAAGG - Intergenic
974549441 4:63351317-63351339 TATGTGAAAAAACATCCTGGAGG + Intergenic
974720028 4:65726219-65726241 CAAGTTAGAAAACATTCTTCAGG + Intergenic
974820993 4:67066950-67066972 CAAGTTGGAAAACACTCTGTAGG - Intergenic
975157541 4:71088988-71089010 CAAGTTGGAAAACATTCTGCAGG - Intergenic
975522445 4:75314982-75315004 CAAGTTGGAAAACATTCTGCAGG + Intergenic
977178118 4:93839768-93839790 AATGTGAGAAAACTTTGTATGGG - Intergenic
977468258 4:97408993-97409015 CATATAAGGAAACATTATGTTGG + Intronic
978150440 4:105427757-105427779 CAAGTGAGAAATCACTCTTTAGG + Intronic
978196996 4:105983638-105983660 CAAGTTGGAAAACATTCTGCAGG - Intronic
978231583 4:106407029-106407051 CAAGTGGGAAAACACTCTGCAGG - Intergenic
978663681 4:111156281-111156303 CATGAGAGAAAACCTTCTGAAGG - Intergenic
979315235 4:119254303-119254325 CAAGTTAGAAAACACTCTGCAGG - Intronic
979325308 4:119372386-119372408 CATGTGGGAAATAATGCTGTGGG - Intergenic
979813308 4:125065874-125065896 CATGTGAGAACACCATCTGGAGG + Intergenic
980060360 4:128122033-128122055 TATGTGAAAAAACATCCTGGAGG + Exonic
980090268 4:128436086-128436108 CAAGTTGGAAAACATTCTGCAGG - Intergenic
980316499 4:131208610-131208632 CATGTTGGAAAACACTCTGCAGG - Intergenic
980590496 4:134881614-134881636 CTTGTGAGAAGAAATCCTGTTGG + Intergenic
980888511 4:138789006-138789028 CATGTGAGCAGAGATTCTGGAGG + Intergenic
980981843 4:139661075-139661097 AATGGGAGAAAATATTCCGTAGG + Intergenic
981049059 4:140293181-140293203 CATGTGAGAAAACATTCTGTTGG - Intronic
981064195 4:140463863-140463885 CATATGAGAAAATATTCTTCTGG + Intronic
981190071 4:141852126-141852148 CATGTGAGAAAACAGTGAGGAGG - Intergenic
981539017 4:145828927-145828949 CATGAGACAAAACTCTCTGTTGG - Intronic
981558048 4:146016683-146016705 CATGTGAGAAGACATTGAATTGG - Intergenic
982625322 4:157759395-157759417 CAAGTTAGAAAACACTCTTTAGG - Intergenic
982954122 4:161740938-161740960 CATGTGAGAAGACATTGAGAAGG - Intronic
983673717 4:170267878-170267900 CAAGTTAGAAAACACTCTGCAGG - Intergenic
983851235 4:172583191-172583213 CATGTGAGAAAATACTCACTAGG + Intronic
985900522 5:2786077-2786099 TATTTGAGAATACATTCTGTAGG + Intergenic
986877311 5:12127209-12127231 CAAGTTAGAAAACACTCTTTAGG + Intergenic
986902952 5:12459561-12459583 CATATGGGAATACATTCTGAGGG + Intergenic
986997763 5:13626676-13626698 CATCAGAGAAAACATTTTGTAGG + Intergenic
987528048 5:19079260-19079282 CAAGTGGGAAAACATTCTTCAGG - Intergenic
987868850 5:23584881-23584903 AATTTGTGAAAAGATTCTGTGGG - Intergenic
988880415 5:35495790-35495812 CAAGTTGGAAAACATTCTGCAGG + Intergenic
989420465 5:41234111-41234133 CCTGTGGGAAAGAATTCTGTAGG - Intronic
989768643 5:45116397-45116419 CAAGTTAGAAAACACTCTGCAGG - Intergenic
989778987 5:45242423-45242445 CAAGTTGGAAAACACTCTGTAGG - Intergenic
989831605 5:45926334-45926356 CAAGTTAGAAAACACTCTGCAGG - Intergenic
990048964 5:51471310-51471332 CCTGTGAGAATATATGCTGTAGG - Intergenic
990884287 5:60574542-60574564 CAAGTTGGAAAACATTCTGCAGG - Intergenic
991529795 5:67602908-67602930 CAAGTTAGAAAACACTCTGAAGG - Intergenic
992131534 5:73697807-73697829 AATGTGTGAAAACATGTTGTAGG - Intronic
992576611 5:78119748-78119770 CAAGTGGGAAAACACTCTGCAGG + Intronic
992715082 5:79502635-79502657 CATCTTTGAAAACATTCTTTGGG + Intronic
992811719 5:80395706-80395728 CAAGTTAGAAAACACTCTGCAGG - Intergenic
993244428 5:85433002-85433024 CAAGTTGGAAAACATTCTGCAGG + Intergenic
993422509 5:87719926-87719948 CATGTGGGGATACATTCTTTTGG - Intergenic
994565768 5:101443591-101443613 CAAGTTGGAAAACACTCTGTAGG + Intergenic
994623989 5:102195310-102195332 CAAGTTAGAAAACACTCTGCAGG - Intergenic
994780115 5:104078942-104078964 CAAGTTGGAAAACATTCTGCAGG - Intergenic
994796698 5:104310182-104310204 CATGTGAGAAAACATTGTCCAGG - Intergenic
995309443 5:110693862-110693884 CAAGTTGGAAAACACTCTGTAGG + Intronic
995326064 5:110891635-110891657 CAAGTGAGAAAACACTCTTCAGG - Intergenic
996001576 5:118370411-118370433 CCTGTGAAAAAATATTCTATAGG + Intergenic
996666220 5:126063401-126063423 CAGGTGAGAAAACATCCTAAGGG - Intergenic
996752998 5:126908404-126908426 CAAGTTGGAAAACATTCTGCAGG - Intronic
997107110 5:131033299-131033321 CAAGTTGGAAAACACTCTGTAGG - Intergenic
997112332 5:131088695-131088717 CAAGTTGGAAAACACTCTGTAGG + Intergenic
997189655 5:131919214-131919236 AATATGACAACACATTCTGTTGG + Intronic
997496174 5:134328060-134328082 CATTTTAGATAACATCCTGTGGG - Intronic
997920070 5:137970018-137970040 CAAGTTGGAAAACATTCTGCAGG + Intronic
998185901 5:139979952-139979974 CATGTGTGAAAATACTCTGTTGG + Intronic
998734769 5:145124384-145124406 TATCTGAAAAAAAATTCTGTAGG + Intergenic
999335907 5:150716326-150716348 CATGTCAAAAAACATTGTGTTGG - Intronic
999542419 5:152587906-152587928 CAAGTGGGAAAACACTCTTTAGG + Intergenic
1000144738 5:158443382-158443404 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1000565882 5:162846823-162846845 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1000683909 5:164223388-164223410 CAGGTGAGAGAACATTCTGAAGG + Intergenic
1000831071 5:166101987-166102009 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1001882038 5:175252848-175252870 AAGGTGTGAAACCATTCTGTGGG - Intergenic
1003679533 6:8238335-8238357 CATTTGACAGTACATTCTGTAGG - Intergenic
1003930983 6:10923982-10924004 CACCTTAGAAAAAATTCTGTAGG - Intronic
1003960974 6:11209081-11209103 CATATTAGAAAACAGTATGTAGG - Intronic
1003977384 6:11356869-11356891 CATGTAAGAAAAGTTTCTGCTGG + Intronic
1004528491 6:16431287-16431309 CAATTGAGAGAACATTCTGCTGG + Intronic
1005028101 6:21483421-21483443 CCTGTGACAGAGCATTCTGTTGG - Intergenic
1008069197 6:47082394-47082416 AAAGTGACAATACATTCTGTTGG - Intergenic
1008254309 6:49277320-49277342 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1008388342 6:50920416-50920438 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1008399313 6:51046450-51046472 CATGTGAAAAAGGATTCTATGGG - Intergenic
1008529881 6:52447145-52447167 CAAGTTGGAAAACATTCTGCAGG - Intronic
1008963376 6:57289363-57289385 CAAGTAAGAAAACATTCTTCAGG + Intergenic
1009280007 6:61736831-61736853 AATGAGAGAAAACATGCTATTGG - Intronic
1009710708 6:67314718-67314740 CATGATAGAAAACATTATGGAGG - Intergenic
1010129191 6:72470982-72471004 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1010137432 6:72571557-72571579 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1010461284 6:76117342-76117364 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1010725076 6:79324235-79324257 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1011288751 6:85753195-85753217 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1011358394 6:86496690-86496712 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1012481761 6:99675387-99675409 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1012680310 6:102171088-102171110 CAAGTGGGAAAACACTCTGCAGG + Intergenic
1012757332 6:103248680-103248702 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1012792093 6:103710447-103710469 CAAGTGGGAAAACACTCTGCAGG + Intergenic
1012969894 6:105717672-105717694 CAAGTGGGAAAACACTCTGCAGG + Intergenic
1013600744 6:111702546-111702568 CATGTGAGAAAGCAGTCTCTCGG - Intronic
1013606468 6:111753693-111753715 CATGTGTAAAAACAATTTGTGGG + Intronic
1013610932 6:111794254-111794276 CATCTGACAAAAAATTGTGTGGG + Intronic
1014702819 6:124711402-124711424 CAAGTTAGAAAACACTCTGCAGG - Intronic
1014711014 6:124806047-124806069 CAAGTTGGAAAACATTCTGCAGG + Intronic
1015050227 6:128831007-128831029 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1015081107 6:129226915-129226937 CAAGTTGGAAAACATTCTGCAGG - Intronic
1015294347 6:131573565-131573587 AATATGAGAAAACATTCTGTAGG - Intronic
1015509655 6:134025532-134025554 CAAAAGAGAAAACATTCTGTCGG - Intronic
1017505264 6:155062946-155062968 CATCAGAGAAGACATACTGTTGG - Intronic
1017982644 6:159414870-159414892 AGTGTGAGAAAACACTCTGTAGG + Intergenic
1018725378 6:166608686-166608708 CTTGTGAGGGACCATTCTGTAGG - Intronic
1018797881 6:167201303-167201325 CATGTGAGCAGACATTCAGGTGG - Intergenic
1019238894 6:170648457-170648479 CAAGTTAGAAAACACTCTTTGGG - Intergenic
1021156509 7:17216746-17216768 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1022381296 7:29862352-29862374 CATATGATAAAAGATACTGTAGG + Intronic
1022790777 7:33686976-33686998 CATGTGATAAAAAGTTTTGTAGG + Intergenic
1022884787 7:34631711-34631733 CATGTTGGAAAACACTCTGCAGG - Intergenic
1023034846 7:36121498-36121520 CATGTTAGAAAACACTCTTCAGG + Intergenic
1023119990 7:36899491-36899513 CATGAAAGAAAACATGCTTTTGG + Intronic
1023199189 7:37675443-37675465 CATATGAGAAAACAGAATGTTGG + Intergenic
1024679533 7:51670605-51670627 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1024892490 7:54219663-54219685 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1025577659 7:62668402-62668424 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1026451515 7:70533528-70533550 CACGGGAGAAAACATTCTAAGGG - Intronic
1026459583 7:70601943-70601965 CAGGTGAGAAAAAAGTTTGTAGG + Intronic
1027435586 7:78160711-78160733 CTACTGAGAAAACATTCTGTGGG - Intronic
1027913195 7:84279709-84279731 CATATTAGAAAACCTTTTGTTGG - Intronic
1027992329 7:85378168-85378190 CATGTTAGAGAACATTATGATGG + Intergenic
1028395383 7:90363718-90363740 CAAGTCAGAAAACACTCTGCAGG - Intronic
1028643701 7:93072395-93072417 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1028821745 7:95219552-95219574 CAAGTTGGAAAACACTCTGTAGG - Intronic
1029253210 7:99251528-99251550 ATTGTGCGAAAACATTCTCTGGG + Intergenic
1030269005 7:107650916-107650938 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1030477235 7:110051196-110051218 TTTGTGAGTATACATTCTGTTGG - Intergenic
1031087220 7:117314669-117314691 CATGTAAGAAAAGATGCTCTGGG + Intronic
1031765113 7:125768495-125768517 CATCTGAGAAAACAATGTTTTGG + Intergenic
1032368466 7:131323064-131323086 CTGGTGAGAAAAAATTTTGTTGG + Intronic
1032603897 7:133329001-133329023 CAAGTTAGAAAACATTCTTCAGG - Intronic
1033287118 7:140050740-140050762 CATAAGAGAAAACATTCTGTAGG + Intronic
1033504260 7:141984670-141984692 CAAGTTGGAAAACATTCTGCAGG - Intronic
1034046026 7:147928566-147928588 AATGTCAGAAAACAATCTATAGG + Intronic
1034675672 7:152891209-152891231 CATGTGGGAAAGCACTGTGTGGG - Intergenic
1035559484 8:593918-593940 GATGTGAGCAAACATTGTGAGGG + Intergenic
1035791130 8:2306549-2306571 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1035801675 8:2415156-2415178 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1036128932 8:6090356-6090378 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1036211993 8:6849667-6849689 CAAGTGGGAAAACACTCTGCAGG - Intergenic
1037232162 8:16671533-16671555 CAAGTTGGAAAACACTCTGTGGG + Intergenic
1038116377 8:24560245-24560267 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1039719047 8:40142780-40142802 CATGTTGGAAAACACTCTGCAGG - Intergenic
1039874234 8:41572026-41572048 AATCAGAGAAAACTTTCTGTTGG + Intergenic
1040140487 8:43903866-43903888 CAAGTTAGAAAACACTCTGCAGG - Intergenic
1040411595 8:47159659-47159681 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1041634614 8:60129245-60129267 CAAGTTAGAAAACATTCTTCAGG - Intergenic
1041635787 8:60141930-60141952 CATCTGAGATAAAATTCTTTAGG - Intergenic
1042698383 8:71583161-71583183 CAAGTTGGAAAACATTCTGCAGG + Intronic
1042786486 8:72552215-72552237 AATGGCAGAAAAAATTCTGTTGG - Intronic
1043146737 8:76666600-76666622 CATCTTAGAATACATTCTGAAGG + Intergenic
1043265699 8:78265612-78265634 CTGGTGAGGAAACATTCTGCAGG + Intergenic
1043601370 8:81942479-81942501 TAGATGAGAAAACCTTCTGTTGG + Intergenic
1044030308 8:87227824-87227846 CAAGTTAGAAAACACTCTGCAGG - Intronic
1044099421 8:88114604-88114626 TATGTGACAAAACGTTCTCTAGG + Intronic
1044121510 8:88402586-88402608 CATCTGAGAAAATATCCTGAGGG - Intergenic
1044169097 8:89026878-89026900 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1044548415 8:93484784-93484806 CAAGTTGGAAAACATTCTTTAGG + Intergenic
1045240938 8:100400781-100400803 CTTGTTAGAAAAAAATCTGTAGG - Intronic
1045351285 8:101342570-101342592 CATATCAGAAGACATGCTGTTGG - Intergenic
1045788846 8:105957208-105957230 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1045938986 8:107716510-107716532 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1046104555 8:109649911-109649933 CATGTGATTAGACAATCTGTTGG + Intronic
1046194613 8:110844073-110844095 CATATGAGAGAACATTATTTTGG - Intergenic
1049860970 8:144898524-144898546 CATGTGGGAAAACATTTTTTGGG + Intronic
1050597417 9:7217517-7217539 CAAGTTAGAAAACATTCTTCAGG + Intergenic
1051537791 9:18179434-18179456 CAAGTGGGAAAACACTCTGCAGG + Intergenic
1052096419 9:24390058-24390080 CAAGTGGGAAAACATTCTTCAGG - Intergenic
1052117531 9:24667418-24667440 CAAGTTAGAAAACACTCTGCAGG - Intergenic
1052615441 9:30834070-30834092 TATATGAGAGAACATTCTGGCGG - Intergenic
1053466318 9:38311318-38311340 CATGTGAGGAAAGCTTCTGGTGG - Intergenic
1055375882 9:75648075-75648097 CAGGGGAGAAAACACTCTGTGGG + Intergenic
1055853382 9:80658696-80658718 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1059742822 9:117169671-117169693 CATGTTAACGAACATTCTGTGGG + Intronic
1203731501 Un_GL000216v2:95660-95682 CATATGAGATAAAATTCTATAGG + Intergenic
1187116170 X:16353665-16353687 CATGTCAGAAAGCCTGCTGTTGG - Intergenic
1187197929 X:17105924-17105946 CTTGTGATAAAACAGTCTCTGGG + Intronic
1187291424 X:17957698-17957720 CATATGAGCAAACATTATTTGGG - Intergenic
1187307214 X:18106307-18106329 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1188109555 X:26181123-26181145 CAAGTTGGAAAACACTCTGTAGG - Intergenic
1188277186 X:28214942-28214964 CATGTGTGAAATTATTCAGTAGG + Intergenic
1189367076 X:40397120-40397142 CATGAGAGAGAATATTCTGATGG + Intergenic
1189832366 X:44987991-44988013 CAAGTTGGAAAACATTCTGCAGG - Intronic
1191015949 X:55810636-55810658 CAAGTTGGAAAACAATCTGTGGG - Intergenic
1191072796 X:56420218-56420240 CAAGTGGGAAAACACTCTGCAGG - Intergenic
1191181300 X:57566479-57566501 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1192030864 X:67510759-67510781 CATGTAAGAAAACATACTTCAGG + Intergenic
1192045064 X:67663708-67663730 CAAGTTGGAAAACACTCTGTAGG - Intronic
1192154962 X:68737794-68737816 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1192352378 X:70367834-70367856 CAAGTTGGAAAACACTCTGTAGG - Intronic
1192376583 X:70568989-70569011 CAAGTTGGAAAACACTCTGTAGG - Intronic
1192924084 X:75737454-75737476 CATGAGAGAAAACCTTCCATTGG + Intergenic
1192943315 X:75936302-75936324 CAAGTGGGAAAACACTCTGAAGG - Intergenic
1192947582 X:75982877-75982899 CATGAGAGAAAACCTTCCATGGG + Intergenic
1193003533 X:76590207-76590229 CAAGTTAGAAAACACTCTTTAGG - Intergenic
1193004580 X:76601668-76601690 CAAGTTAGAAAACACTCTGCAGG - Intergenic
1193267944 X:79495351-79495373 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1193391854 X:80938113-80938135 CAAGTTAGAAAACACTCTGCAGG + Intergenic
1193395685 X:80981362-80981384 CAAGTGGGAAAACACTCTGCAGG - Intergenic
1193461210 X:81792620-81792642 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1193542596 X:82789827-82789849 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1193770777 X:85584706-85584728 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1194068793 X:89294047-89294069 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1195088831 X:101439560-101439582 CAAGTTGGAAAACATTCTGCAGG - Intronic
1195103907 X:101584618-101584640 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1195117591 X:101715663-101715685 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1195874180 X:109521156-109521178 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1196747830 X:119087398-119087420 AATAAGAGAAAACTTTCTGTGGG + Exonic
1197607572 X:128602664-128602686 CATGTAAGAAAAAACTCTTTGGG + Intergenic
1198057723 X:133011224-133011246 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1198078945 X:133220421-133220443 CATGTGAGAAAACATAAATTTGG - Intergenic
1200357756 X:155569393-155569415 CAAGTTGGAAAACATTCTGCAGG + Intronic
1200388335 X:155916939-155916961 CAAGTTGGAAAACATTCTTTAGG - Intronic
1200722938 Y:6628202-6628224 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1201176201 Y:11309822-11309844 TATGTCAGAAAGCCTTCTGTAGG + Intergenic
1201244796 Y:11993038-11993060 CATGTTGGAAAACACTCTGCAGG - Intergenic
1201401091 Y:13604744-13604766 CATCTGAGAAAACACTCAGAGGG + Intergenic
1201494137 Y:14575172-14575194 CAAGTGGGAAAACACTCTGCAGG - Intronic
1201778656 Y:17694656-17694678 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1201783466 Y:17747300-17747322 CAAGTTGGAAAACATTCTTTGGG + Intergenic
1201818087 Y:18158687-18158709 CAAGTTGGAAAACATTCTTTGGG - Intergenic
1201822900 Y:18211336-18211358 CAAGTTGGAAAACATTCTGCAGG + Intergenic
1201919427 Y:19218537-19218559 CAAGTTAGAAAACACTCTGCAGG - Intergenic
1201956782 Y:19633446-19633468 CAAGTTGGAAAACATTCTGCAGG - Intergenic
1202374689 Y:24223430-24223452 CAAGTTGGAAAACACTCTGTAGG + Intergenic
1202496091 Y:25446690-25446712 CAAGTTGGAAAACACTCTGTAGG - Intergenic