ID: 981049063

View in Genome Browser
Species Human (GRCh38)
Location 4:140293217-140293239
Sequence CTGGGCTGCCACTAGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981049058_981049063 14 Left 981049058 4:140293180-140293202 CCCAACAGAATGTTTTCTCACAT 0: 1
1: 0
2: 0
3: 23
4: 378
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049056_981049063 16 Left 981049056 4:140293178-140293200 CCCCCAACAGAATGTTTTCTCAC 0: 1
1: 0
2: 2
3: 24
4: 183
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049055_981049063 23 Left 981049055 4:140293171-140293193 CCATTCTCCCCCAACAGAATGTT 0: 1
1: 1
2: 0
3: 25
4: 266
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049057_981049063 15 Left 981049057 4:140293179-140293201 CCCCAACAGAATGTTTTCTCACA 0: 1
1: 0
2: 1
3: 18
4: 268
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data
981049059_981049063 13 Left 981049059 4:140293181-140293203 CCAACAGAATGTTTTCTCACATG 0: 1
1: 0
2: 2
3: 34
4: 489
Right 981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981049063 Original CRISPR CTGGGCTGCCACTAGGTGCC AGG Intronic
No off target data available for this crispr