ID: 981049152

View in Genome Browser
Species Human (GRCh38)
Location 4:140293791-140293813
Sequence TTCCATCACCATAGTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981049152_981049163 18 Left 981049152 4:140293791-140293813 CCATGGCCACTATGGTGATGGAA 0: 1
1: 0
2: 3
3: 19
4: 204
Right 981049163 4:140293832-140293854 TCATGGAGGCAGCCATCAAGGGG No data
981049152_981049159 4 Left 981049152 4:140293791-140293813 CCATGGCCACTATGGTGATGGAA 0: 1
1: 0
2: 3
3: 19
4: 204
Right 981049159 4:140293818-140293840 CCCATGTATAGGATTCATGGAGG No data
981049152_981049161 16 Left 981049152 4:140293791-140293813 CCATGGCCACTATGGTGATGGAA 0: 1
1: 0
2: 3
3: 19
4: 204
Right 981049161 4:140293830-140293852 ATTCATGGAGGCAGCCATCAAGG No data
981049152_981049162 17 Left 981049152 4:140293791-140293813 CCATGGCCACTATGGTGATGGAA 0: 1
1: 0
2: 3
3: 19
4: 204
Right 981049162 4:140293831-140293853 TTCATGGAGGCAGCCATCAAGGG No data
981049152_981049154 -7 Left 981049152 4:140293791-140293813 CCATGGCCACTATGGTGATGGAA 0: 1
1: 0
2: 3
3: 19
4: 204
Right 981049154 4:140293807-140293829 GATGGAACACCCCCATGTATAGG 0: 1
1: 0
2: 0
3: 3
4: 47
981049152_981049155 1 Left 981049152 4:140293791-140293813 CCATGGCCACTATGGTGATGGAA 0: 1
1: 0
2: 3
3: 19
4: 204
Right 981049155 4:140293815-140293837 ACCCCCATGTATAGGATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981049152 Original CRISPR TTCCATCACCATAGTGGCCA TGG (reversed) Intronic
902168194 1:14589567-14589589 TTCCAACACCAAAGTGCCCCGGG - Intergenic
903658997 1:24965600-24965622 GTCCACCACCATTGTTGCCAGGG + Intergenic
904921638 1:34012867-34012889 TTCCTTCAACATAGCTGCCAGGG + Intronic
905900268 1:41576740-41576762 TTCCAGCACCAGATAGGCCATGG + Intronic
906075923 1:43051983-43052005 CTCCACCTCCATAGTGGCCCTGG - Intergenic
909533746 1:76709922-76709944 TTACAGCACCCCAGTGGCCATGG + Intergenic
909811060 1:79932176-79932198 TCCCATGAACAAAGTGGCCATGG + Intergenic
910370753 1:86512977-86512999 ATCCATGAACAAAGTGGCCATGG + Intergenic
910397358 1:86806063-86806085 TTGCATCAGCATAGTGGACATGG + Intergenic
910428411 1:87138346-87138368 TTCAATCACCAAGATGGCCAAGG - Intronic
912212363 1:107569702-107569724 GCCCATCAACAAAGTGGCCATGG + Intergenic
913698239 1:121348335-121348357 TTCCATCTGCACTGTGGCCAGGG + Intronic
914139310 1:144931717-144931739 TTCCATCTGCACTGTGGCCAGGG - Intronic
916939615 1:169665105-169665127 TTGCCTCAGCATAGTGGACATGG - Intronic
918929030 1:190829462-190829484 TTCCATAATTATTGTGGCCAGGG + Intergenic
920485638 1:206366991-206367013 TTCCATCTGCACTGTGGCCAGGG + Intronic
920611294 1:207440286-207440308 TTCCATCAGCATAAGGACCAGGG + Intergenic
920611374 1:207441151-207441173 TTCCATCAGCATAAGGACCATGG - Intergenic
921367796 1:214390707-214390729 TTCCATCAGCATACAGCCCATGG - Intronic
924147268 1:241089193-241089215 CTCCATGACCAGAGTTGCCATGG + Intronic
1063321612 10:5057143-5057165 TTGCCTCAGCATAGTGGACATGG + Intronic
1064603470 10:17015749-17015771 TTGCCTCAGCATAGTGGACATGG + Intronic
1065082515 10:22141892-22141914 TTGCCTCAGCATAGTGGACATGG - Intergenic
1066957734 10:42188899-42188921 GCCCATGAACATAGTGGCCATGG + Intergenic
1069308891 10:67008309-67008331 TTCAATAACCATAGTGCTCATGG + Intronic
1072060252 10:91803054-91803076 TTTCATCACCGTAGAGGCCATGG + Intronic
1074613135 10:115040139-115040161 TTGCTTCAGCATAGTGGACATGG - Intergenic
1077154411 11:1084993-1085015 TCCCATCCCCAGGGTGGCCAGGG - Intergenic
1077639480 11:3868609-3868631 TTCTATCACCCAAGTGGCCTGGG + Intronic
1077803954 11:5571333-5571355 CTCCACCACCATAGGGGCCAGGG + Intronic
1078096249 11:8299058-8299080 TTGAATCATCATATTGGCCAGGG + Intergenic
1079134545 11:17768926-17768948 CTCCATCACCAGAGTTGCCAAGG - Intronic
1079612329 11:22448403-22448425 ATCCTTCATCCTAGTGGCCAAGG + Intergenic
1081033532 11:38114577-38114599 TTGCCTCAGCATAGTGGACATGG - Intergenic
1081421525 11:42878055-42878077 TTGCCTCAGCATAGTGGACATGG - Intergenic
1083043776 11:59713599-59713621 TTCCATCACCCCATTGGCCTTGG - Exonic
1084211107 11:67623117-67623139 TTGCCTCAGCATAGTGGACACGG - Intergenic
1084397374 11:68921347-68921369 TCCCAGCACCAAGGTGGCCAAGG - Intronic
1084650674 11:70487452-70487474 CTCCCTCATCATGGTGGCCACGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085648750 11:78247317-78247339 TTCCACCACCATAGTGGAACTGG + Intronic
1087319363 11:96639483-96639505 TTGCCTCAGCATAGTGGACATGG - Intergenic
1087683239 11:101237578-101237600 TTGCCTCAGCATAGTGGACATGG + Intergenic
1090390811 11:126386161-126386183 TTCTATCCCCCCAGTGGCCAAGG + Intronic
1090765172 11:129870129-129870151 TTCCATCACCACAGATGCCAAGG - Exonic
1091015065 11:132043106-132043128 TTCCATCATTCTAATGGCCAAGG + Intronic
1092472409 12:8791354-8791376 TTGCCTCAGCATAGTGGACATGG - Intergenic
1092794420 12:12095757-12095779 TTCCATCAGCAAAGAGACCAAGG - Intronic
1093031752 12:14295113-14295135 TCCCATGAACAAAGTGGCCATGG - Intergenic
1093345345 12:18034365-18034387 TTGCCTCAGCATAGTGGACATGG - Intergenic
1093580492 12:20780210-20780232 TTGCCTCAGCATAGTGGACATGG + Intergenic
1097266570 12:57749089-57749111 TTCATTAACCACAGTGGCCAGGG + Intronic
1099689885 12:85938843-85938865 GTCCATGAACAAAGTGGCCATGG + Intergenic
1100256087 12:92884596-92884618 CTCCACCACCATAGGGGCCAGGG - Intronic
1105740229 13:23316003-23316025 TCCCATGAACAAAGTGGCCATGG + Intronic
1106575201 13:30968033-30968055 TATCACCATCATAGTGGCCAAGG + Intronic
1107059011 13:36135502-36135524 CTCCATCACCTTACTGCCCACGG + Intergenic
1109042090 13:57352070-57352092 TTTCATGACCATAGTGGCCCTGG + Intergenic
1112231010 13:97589349-97589371 TCCCATGAACAAAGTGGCCATGG - Intergenic
1114905281 14:27119737-27119759 GTCCATGAACAAAGTGGCCATGG - Intergenic
1116432543 14:44863692-44863714 TGCTATCATCATAGTAGCCAGGG + Intergenic
1117290037 14:54323249-54323271 ACCCATCACCATAGTACCCAGGG + Intergenic
1118248355 14:64133864-64133886 TTCCATCACCTTTGAGGACAAGG - Intronic
1118880661 14:69823194-69823216 TCCCATGAACAAAGTGGCCATGG - Intergenic
1119039224 14:71257493-71257515 TTCCATCACCATCAGGCCCAAGG - Intergenic
1119646334 14:76351110-76351132 CTCCAGCCCCACAGTGGCCAGGG - Intronic
1202866475 14_GL000225v1_random:122289-122311 TTCCATCACCTTGGTGATCAGGG - Intergenic
1202935370 14_KI270725v1_random:82877-82899 GACCATGAACATAGTGGCCATGG - Intergenic
1131411310 15:92210376-92210398 TTGCTTCAGCATAGTGGACATGG - Intergenic
1132342580 15:101087697-101087719 TTCCATCACAATGGAGGCCATGG + Intergenic
1135757724 16:25111882-25111904 TTCCCTCTGCCTAGTGGCCATGG - Exonic
1136029216 16:27490514-27490536 TGCCACCACCATATGGGCCAAGG - Intronic
1137807536 16:51321502-51321524 TTCCAGCAGCTTAGTGGCAAGGG - Intergenic
1138624877 16:58243480-58243502 TTCCAACACCTTAGTGGGAATGG + Intronic
1140025846 16:71289550-71289572 TTCCGTTGCCATAGTGGCCGGGG - Exonic
1141955975 16:87371550-87371572 CTCCATCACCCCGGTGGCCAGGG + Intronic
1142256796 16:89017698-89017720 TGCCCTCACCAAAGAGGCCAAGG + Intergenic
1142643346 17:1297349-1297371 TTCCCTCTCCTAAGTGGCCAAGG - Intronic
1146310614 17:31765553-31765575 TTCCCTCAGCATAGTGGACATGG - Intergenic
1147202296 17:38811036-38811058 GTCTTTCACCATATTGGCCAGGG - Intronic
1147357776 17:39911124-39911146 TTCATTCACCCTATTGGCCAGGG - Intronic
1148021911 17:44558837-44558859 GACCATCACCATCCTGGCCATGG + Exonic
1150722701 17:67627055-67627077 TTTTACCACCATATTGGCCAGGG - Intronic
1155546697 18:26923185-26923207 ATCTATTACCATAGTGGCAAAGG + Intronic
1156546336 18:37967364-37967386 GTTCATCAACAAAGTGGCCATGG + Intergenic
1156998685 18:43498547-43498569 GTCCATGAACAAAGTGGCCATGG + Intergenic
1160616982 18:80137885-80137907 TTTCATCACCATATTGCCAAAGG + Exonic
1161598132 19:5162852-5162874 TTGCCTCAGCATAGTGGACATGG + Intronic
1162026814 19:7899071-7899093 TGCGGCCACCATAGTGGCCATGG + Exonic
1164462865 19:28463710-28463732 TCCCATCACCATGGAGACCAGGG + Intergenic
1167013886 19:46826980-46827002 CTCCATCACCATAGGGGCCAGGG + Intergenic
928891163 2:36204855-36204877 ATCCTGCACCACAGTGGCCAAGG - Intergenic
929994136 2:46814603-46814625 TTCCATCACCACACTGGCCATGG - Intergenic
930218903 2:48725890-48725912 TTCCATCCCCAGAGTCGCTAGGG - Intronic
932870588 2:75394265-75394287 GCCCATGACCAAAGTGGCCATGG - Intergenic
933342246 2:81038330-81038352 TTGCCTCAGCATAGTGGACATGG - Intergenic
934305851 2:91821413-91821435 GCCCATGAACATAGTGGCCATGG + Intergenic
934327405 2:92031329-92031351 GCCCATGAACATAGTGGCCATGG - Intergenic
934465789 2:94261909-94261931 GCCCATGAACATAGTGGCCATGG - Intergenic
934867225 2:97824170-97824192 TTGCCTCAGCATAGTGGACATGG - Intronic
938049916 2:128159642-128159664 CTTCATCACCAAAATGGCCAAGG + Exonic
939732107 2:145797381-145797403 TTCCATAAACATAGTGATCAAGG + Intergenic
941537462 2:166741086-166741108 TTGCCTCAGCATAGTGGACATGG + Intergenic
942946777 2:181681602-181681624 TTCCAGCAACCCAGTGGCCATGG - Intergenic
943664072 2:190590023-190590045 GTCCATCACCATAATGGACAAGG + Intergenic
945501764 2:210584327-210584349 TTCCATCACCAGTGTGGCAATGG + Intronic
946028897 2:216689889-216689911 AACCAACAGCATAGTGGCCAAGG + Intronic
948826119 2:240574137-240574159 CTCCTTCCCCATCGTGGCCATGG + Exonic
1172858053 20:38023438-38023460 TTCCCACACCTCAGTGGCCATGG - Intronic
1176051005 20:63119764-63119786 TTCCATCCTCATGGTGGCCGGGG - Intergenic
1176596791 21:8705113-8705135 GCCCATGAACATAGTGGCCATGG - Intergenic
1176998280 21:15581086-15581108 TCCCATGAACAAAGTGGCCATGG + Intergenic
1179415030 21:41191718-41191740 GTCCATGAACAAAGTGGCCATGG - Intronic
1180279711 22:10682555-10682577 GCCCATGAACATAGTGGCCATGG - Intergenic
1180591038 22:16937547-16937569 GCCCATGAACATAGTGGCCATGG - Intergenic
1183907208 22:41050415-41050437 GTCCATCACTAGAGTGGCTAAGG - Intergenic
949205059 3:1428060-1428082 TTCCATAAACACAGTGGCCCTGG + Intergenic
949332884 3:2941719-2941741 TTCCATTACCATTCTGGCTATGG - Intronic
949417465 3:3830070-3830092 GTCCATGAACAAAGTGGCCATGG - Intronic
950446573 3:13042241-13042263 TCCCATTGCCCTAGTGGCCAAGG + Intronic
952554961 3:34521236-34521258 TTGCCTCAGCATAGTGGACAGGG + Intergenic
952994917 3:38870448-38870470 TTCTTTCTCCATGGTGGCCAAGG - Intronic
953622848 3:44547845-44547867 TTGCCTCAGCATAGTGGACATGG + Intergenic
959663980 3:108901242-108901264 TCCCATCCCCATGGTTGCCATGG - Intergenic
960667836 3:120127905-120127927 TTCCAGCACTTTAGAGGCCAAGG - Intergenic
963130875 3:141856425-141856447 TCCCAGCACCAAAGAGGCCAAGG - Intergenic
967583743 3:191188840-191188862 TTGCCTCGCCATAGTGGACATGG - Intergenic
968123621 3:196143080-196143102 TTCCAGCACCCTGATGGCCATGG - Intergenic
970377919 4:15477810-15477832 TTCCCTAACCCCAGTGGCCAAGG + Intronic
974537219 4:63187716-63187738 TTGCCTCAGCATAGTGGACATGG - Intergenic
975595750 4:76047102-76047124 TTGCCTCAGCATAGTGGACATGG + Intronic
978585362 4:110270921-110270943 ATCCATCACCACAGTGGCTGGGG - Intergenic
978898955 4:113925994-113926016 GTCCATGAACAAAGTGGCCATGG - Intronic
981049152 4:140293791-140293813 TTCCATCACCATAGTGGCCATGG - Intronic
982877372 4:160665435-160665457 TTGCCTCAGCATAGTGGACATGG - Intergenic
984751901 4:183286212-183286234 CCCCATCTCCATAGTGGCCATGG - Intronic
988463004 5:31458302-31458324 TTCCATCACCATATTGGTGGTGG + Intronic
988501893 5:31790427-31790449 GCCCATCACAAAAGTGGCCATGG - Intronic
988924438 5:35975173-35975195 TTTCATAAACACAGTGGCCATGG + Intronic
989503747 5:42201263-42201285 TTCCATGACCATTGCTGCCACGG + Intergenic
990367788 5:55088090-55088112 TTGCCTCAGCATAGTGGACATGG + Intergenic
990444628 5:55882675-55882697 TTCCATCATCCTAGGGGTCAAGG + Intronic
990448393 5:55914074-55914096 TTTCTTCCCCACAGTGGCCAGGG - Intronic
992243069 5:74790671-74790693 GTCCATGAACAAAGTGGCCATGG + Intronic
992532752 5:77668329-77668351 TTCAATGACCAAAGTGGCAAGGG + Intergenic
992545844 5:77813098-77813120 TTGCATCAGCATAGTGGACATGG - Intronic
992945356 5:81803884-81803906 TTGGATTACCATTGTGGCCATGG - Intergenic
993980734 5:94540475-94540497 TGCCATCACAATGGTGGCCCAGG + Intronic
995535435 5:113130980-113131002 TACCATCACAATAGGGGCTAGGG + Intronic
996029352 5:118687574-118687596 TTCCATCATCAAAGTACCCATGG + Intergenic
1001041757 5:168341213-168341235 TGTCATCATCAGAGTGGCCAGGG + Intronic
1001269534 5:170301056-170301078 TGCCATGACCATGGAGGCCAGGG + Intergenic
1003614127 6:7639932-7639954 TTCCATCACGCTGGGGGCCAGGG + Intergenic
1003960945 6:11208635-11208657 CTCCATCAGCACAGGGGCCATGG - Intronic
1004645187 6:17553738-17553760 TTCCCACACCATAATGCCCATGG - Intronic
1007030109 6:38619502-38619524 TTGCCTCAGCATAGTGGACATGG - Intronic
1007690651 6:43699120-43699142 TTCCATCACCTTAGATACCAGGG + Intergenic
1008191586 6:48464344-48464366 TTACATCACCATAGTGGGACTGG + Intergenic
1009872850 6:69471212-69471234 TTGCCTCAGCATAGTGGACATGG - Intergenic
1012441482 6:99265725-99265747 TTGCCTCAGCATAGTGGACATGG + Intergenic
1014319158 6:119905189-119905211 TTCCATAACCATATCGGCCAGGG - Intergenic
1017403525 6:154091906-154091928 ATCCATGACCACAGTGGGCAAGG - Intronic
1018060882 6:160088848-160088870 TTTCATCACCACAATGGACAGGG - Intronic
1021970704 7:25963032-25963054 CTCCATCCCCTTGGTGGCCAAGG - Intergenic
1022469084 7:30670932-30670954 TTCCATGCCCAGAGTGGCCCAGG + Intronic
1023242534 7:38163138-38163160 CTCCATCAGCATAATGTCCAGGG - Intergenic
1023806588 7:43877123-43877145 TCCCATGAGCAGAGTGGCCAAGG + Exonic
1025120720 7:56299367-56299389 TTTCAACACCATAGTGCCCAGGG + Intergenic
1026357020 7:69566784-69566806 TTTAATCACCATAGTAACCATGG - Intergenic
1026841451 7:73671623-73671645 GTCCATCACCCTAGAGGCCCCGG - Exonic
1028197127 7:87920234-87920256 CCCCATCCCCACAGTGGCCATGG + Intergenic
1031586591 7:123538140-123538162 TTCCATGACCATAGTGGTGGTGG - Exonic
1034305881 7:150044800-150044822 TACCATCATCTTAGTGACCAAGG + Intergenic
1034461522 7:151200281-151200303 TTCCAGCCCCACAGTGCCCACGG - Intronic
1034800959 7:154055853-154055875 TGCCATCATCTTAGTGACCAAGG - Intronic
1036756321 8:11473590-11473612 TCCCATCCCCATCCTGGCCAGGG + Intronic
1038382156 8:27106145-27106167 CTCCATAATCAAAGTGGCCAAGG + Intergenic
1038638851 8:29308068-29308090 TTGCCTCAGCATAGTGGACACGG - Intergenic
1039693112 8:39882406-39882428 TTGCCTCAGCATAGTGGACATGG + Intergenic
1040337154 8:46421853-46421875 TTTCATCACCAAAGTCCCCAGGG + Intergenic
1040649020 8:49429415-49429437 TTGCCTCAGCATAGTGGACATGG - Intergenic
1040667804 8:49653917-49653939 TTGCCTCAGCATAGTGGACATGG + Intergenic
1040953464 8:52957740-52957762 TTGCCTCAGCATAGTGGACATGG - Intergenic
1041694703 8:60723633-60723655 TTCCTTCAACATAGTGACCTTGG + Intronic
1042004588 8:64167369-64167391 AGCCATCACCATAGTGCCAAGGG - Intergenic
1044053004 8:87533164-87533186 TTCCTTCACCATAGAGGCCAAGG + Intronic
1044487046 8:92766365-92766387 GTCCATGAACAAAGTGGCCATGG - Intergenic
1044967068 8:97584110-97584132 TCCCATCCCCACAGAGGCCAGGG - Intergenic
1048685212 8:136897369-136897391 TACCATCACCTTAGGGGGCAGGG - Intergenic
1049808747 8:144553744-144553766 TGCCATCACCACACTGGCCAAGG + Intronic
1053019490 9:34685020-34685042 TTCCATCTCCCAAGGGGCCAGGG - Intergenic
1053164080 9:35832492-35832514 AGCCATCCCCACAGTGGCCAGGG - Intronic
1053695850 9:40638686-40638708 GCCCATGATCATAGTGGCCATGG - Intergenic
1053942837 9:43269723-43269745 GCCCATGAACATAGTGGCCATGG - Intergenic
1054307097 9:63437904-63437926 GCCCATGATCATAGTGGCCATGG - Intergenic
1054405828 9:64761895-64761917 GCCCATGAACATAGTGGCCATGG - Intergenic
1054439455 9:65247382-65247404 GCCCATGAACATAGTGGCCATGG - Intergenic
1054490952 9:65774557-65774579 GCCCATGAACATAGTGGCCATGG + Intergenic
1056463190 9:86827982-86828004 TTGCAGCAACAAAGTGGCCATGG - Intergenic
1059322008 9:113477247-113477269 TTTCAGGACCACAGTGGCCATGG - Intronic
1059921552 9:119166224-119166246 CTCCTTCAACATAGTTGCCAAGG - Intronic
1060801389 9:126547823-126547845 TCCCCTCACCAAGGTGGCCAGGG + Intergenic
1061194034 9:129097898-129097920 TTCCAGCCCCATGGTGGGCACGG - Intronic
1202778295 9_KI270717v1_random:12298-12320 GCCCATGATCATAGTGGCCATGG - Intergenic
1186273507 X:7915999-7916021 TTCCTGCACCATAGTGTCCCTGG - Intronic
1187524032 X:20037944-20037966 GTCCATGAACAAAGTGGCCACGG + Intronic
1187749534 X:22446604-22446626 TTGTATCACCATTGTTGCCAAGG + Intergenic
1188092965 X:25986154-25986176 TTCCATCTTCAAAGTGGCCATGG - Intergenic
1188097585 X:26043202-26043224 TTGCCTCAGCATAGTGGACATGG - Intergenic
1188136579 X:26500558-26500580 TTGCCTCAGCATAGTGGACATGG - Intergenic
1189331979 X:40149755-40149777 ATCCATCACCATAGGCCCCATGG + Intronic
1189363515 X:40370844-40370866 TTCCATCTCGGTAGTGGCCCAGG - Intergenic
1190541528 X:51482707-51482729 TTGCCTCAGCATAGTGGACATGG - Intergenic
1191658685 X:63628991-63629013 GTCCATGAACAAAGTGGCCATGG - Intergenic
1191769388 X:64739281-64739303 ATCCATGAACAAAGTGGCCATGG - Intergenic
1196127295 X:112113708-112113730 TTACTTCAGCATAGTGGGCAAGG + Intergenic
1199273122 X:145909058-145909080 TTCCAGCACTATAATGGTCAAGG + Intergenic
1201193610 Y:11470602-11470624 ACCCATGAACATAGTGGCCATGG - Intergenic
1201271886 Y:12263621-12263643 TTGCCTCAGCATAGTGGACATGG + Intergenic
1201403815 Y:13630889-13630911 TTGCCTCAGCATAGTGGCCATGG - Intergenic
1201555788 Y:15263799-15263821 TTGCCTCAGCATAGTGGACATGG - Intergenic
1201571860 Y:15423607-15423629 TTCCATTACACTAGTGGCCAGGG - Intergenic
1201796558 Y:17902820-17902842 GTCCATGAACAAAGTGGCCATGG - Intergenic
1201804997 Y:18003165-18003187 GTCCATGAACAAAGTGGCCATGG + Intergenic
1201908167 Y:19106133-19106155 TTGCCTCAGCATAGTGGACATGG + Intergenic
1202080155 Y:21075832-21075854 CACAATCACCATAGTGGGCATGG - Intergenic
1202192554 Y:22259815-22259837 TTGCCTCAGCATAGTGGACATGG + Intergenic