ID: 981050368

View in Genome Browser
Species Human (GRCh38)
Location 4:140303738-140303760
Sequence GAGCTCCATTTCCCTATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981050368_981050370 1 Left 981050368 4:140303738-140303760 CCAGGTATAGGGAAATGGAGCTC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 981050370 4:140303762-140303784 GTATAGTGGAACAGAGTTTCAGG 0: 1
1: 0
2: 1
3: 9
4: 113
981050368_981050371 2 Left 981050368 4:140303738-140303760 CCAGGTATAGGGAAATGGAGCTC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 981050371 4:140303763-140303785 TATAGTGGAACAGAGTTTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 236
981050368_981050372 30 Left 981050368 4:140303738-140303760 CCAGGTATAGGGAAATGGAGCTC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 981050372 4:140303791-140303813 CACTTAGAATTGCTCTGATGTGG 0: 1
1: 0
2: 1
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981050368 Original CRISPR GAGCTCCATTTCCCTATACC TGG (reversed) Intronic
900935345 1:5762635-5762657 CAGCTCCGTTACACTATACCTGG - Intergenic
903972872 1:27130495-27130517 GAGCTCCATTTCCCATTACTAGG - Intronic
908853657 1:68398324-68398346 CAGCTCTATTTCCATCTACCTGG - Intergenic
909109938 1:71462372-71462394 CATCTCCATTGCCCTCTACCTGG - Intronic
909535520 1:76731601-76731623 GAGCTCCATTTTCATATGTCAGG + Intergenic
910961582 1:92769509-92769531 GAGCTCCACATCCCAATACCTGG + Intronic
916300996 1:163274404-163274426 GAGCTTCTTTTCCCTAAACTTGG - Intronic
917636881 1:176945621-176945643 AAGCTCCATTTCCCTATGAATGG - Intronic
918413537 1:184284875-184284897 GCTCTCCTTTTCCCTATTCCAGG - Intergenic
1064231114 10:13529499-13529521 GAGCTCCCATTCCCTAACCCAGG + Intergenic
1064855336 10:19760896-19760918 CAGCTCCTTGTCCATATACCGGG - Intronic
1065064229 10:21943622-21943644 GAGCTCCAGTTGCCTTTACAGGG + Intronic
1069995091 10:72336961-72336983 GGTCTCCAGTTCCCTAGACCAGG - Intronic
1072228830 10:93395559-93395581 GAGAACTATTTGCCTATACCTGG - Intronic
1073984057 10:109187549-109187571 GAGCTGCATTTCCCTAAATTAGG - Intergenic
1074551239 10:114444339-114444361 AAGCTCCATTTCCCTAAGTCAGG + Intronic
1076620306 10:131782999-131783021 GAGATCCAATTCCCTTCACCTGG - Intergenic
1081423112 11:42895932-42895954 GAGCTCTATTTCCCATTTCCTGG + Intergenic
1082637322 11:55612539-55612561 GATCTCCATGTCCTTATATCTGG + Intergenic
1083859392 11:65411881-65411903 GTGCTCCATCCCCCAATACCAGG + Exonic
1088229514 11:107659604-107659626 GAGCACCTTTACCCTGTACCAGG - Intronic
1088362717 11:109007843-109007865 GACATCCATTTTCTTATACCTGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1089316338 11:117593646-117593668 GAGCTCCACATCCCTGTGCCAGG - Intronic
1092282030 12:7105014-7105036 GAGCTGCATCTCCCTCCACCAGG + Intronic
1103839252 12:123849531-123849553 GTGGGCCATTTCCCTACACCGGG + Intronic
1108196363 13:47999844-47999866 GAGCTGCATTTCTTAATACCAGG + Intronic
1109294652 13:60514645-60514667 GAGCACCAATTCCCTGTGCCTGG + Intronic
1116132089 14:40867210-40867232 GAGGTCCCTTTCCCAATACTTGG + Intergenic
1119762051 14:77158628-77158650 GGGCTCCTTTTCCCTAAATCAGG - Intronic
1128460370 15:67862327-67862349 TAGCCCCCTTCCCCTATACCTGG + Intergenic
1129596288 15:76967071-76967093 GGGCTCCAGATCCCTATTCCAGG - Intergenic
1138452799 16:57103743-57103765 GAGCTCCTTTACACTATAGCTGG + Intronic
1138536383 16:57662576-57662598 GAGCTTCCTTCCCCTAGACCAGG - Intronic
1142599813 17:1048090-1048112 GAGCCCCATCTCCCTGTCCCTGG - Intronic
1143691980 17:8575837-8575859 GACCTCCATTTCTCACTACCTGG - Intronic
1148793977 17:50188497-50188519 GGGCTCCAGTTCCCTGTACCTGG - Intronic
1152353535 17:79796105-79796127 GAGCTCCATCTCTCTTTCCCTGG + Exonic
1156547078 18:37974435-37974457 GAACTCCAGTTCTCTCTACCTGG - Intergenic
1160200506 18:76792070-76792092 GACCTACATTTCCAAATACCTGG - Intergenic
1161954562 19:7486076-7486098 GAGCTGCATCCCCCCATACCTGG + Intronic
1164481373 19:28613591-28613613 GAGCTACATTTCCTAATAACTGG - Intergenic
1166414872 19:42588226-42588248 GAGCACCTTTTCCATACACCTGG + Intronic
1166880459 19:45926782-45926804 CAGCTCCATTTCCCTACAGTTGG + Intergenic
926234320 2:11027922-11027944 GAGGTCCATTTCCTAATCCCTGG - Intergenic
927346650 2:22051806-22051828 GATCTCCCTTTCCATATACCTGG + Intergenic
934985448 2:98881653-98881675 GAGCCCCATTTGCATATACATGG - Intronic
936601725 2:113903143-113903165 TTCCTCCATTTCCCAATACCTGG + Intronic
939641529 2:144645427-144645449 GAGCTACATTTCCATATGGCAGG - Intergenic
939865860 2:147471650-147471672 GAGCTACATTTCCTTGTACATGG + Intergenic
942473992 2:176295725-176295747 GAGTTCCTTTTTCCTATTCCAGG + Intronic
947846053 2:233244484-233244506 GAGCTCCAGTTCTCAATTCCTGG - Intronic
948603055 2:239118330-239118352 TGGCTCCATTTCCCTGTGCCAGG - Intronic
1169919428 20:10718724-10718746 GGGCTTCATCACCCTATACCTGG - Intergenic
1171105213 20:22426873-22426895 GAGCTCCATCTCTCTTCACCTGG + Intergenic
1175334679 20:58187500-58187522 GAGCTCCATTCCCCTTTCTCAGG + Intergenic
1176666068 21:9688749-9688771 GAGCTGCTTTTCCCGATATCTGG - Intergenic
1177586144 21:23098292-23098314 GATCTCCATTTCTGTTTACCTGG - Intergenic
1180115442 21:45700666-45700688 GAGCTCCATGTCCCGATACCAGG + Intronic
1182695715 22:32198258-32198280 GAGCTCCTTCCCCCTATTCCTGG + Intronic
1184134714 22:42540734-42540756 TAACTCCTTTTCCCTACACCAGG + Intergenic
1185276831 22:49953533-49953555 CAGGTCCACTTCCCTATTCCTGG - Intergenic
954859064 3:53672152-53672174 GAACCCCATTCCCCTATTCCCGG - Intronic
966210032 3:177443758-177443780 GAGCTCCAATTCCCTTATCCGGG + Intergenic
967459382 3:189727673-189727695 GAGCTCCATTTTCATGTATCTGG + Intronic
969271727 4:6107825-6107847 GAGCTCCAGTTTCCTCTACTAGG + Intronic
969373805 4:6750113-6750135 GAGCTCCCTTTCCCTCTGCCTGG - Intergenic
971318168 4:25584505-25584527 GAGCTGCATTTGTCTATCCCGGG - Intergenic
972062947 4:34903294-34903316 CAGCACCATCTCCCTATTCCAGG + Intergenic
973087482 4:46083828-46083850 TAGCTCCAGTTGCCAATACCTGG + Intronic
973267477 4:48225504-48225526 GATTTCCATCTCCCTATCCCTGG - Intronic
976169519 4:82288412-82288434 CATCTCCTTTTCCCTCTACCTGG + Intergenic
981050368 4:140303738-140303760 GAGCTCCATTTCCCTATACCTGG - Intronic
982627174 4:157781989-157782011 GAGTTCCATTTTCCCATGCCTGG + Intergenic
982692029 4:158559528-158559550 GAGCTTTTTTCCCCTATACCAGG + Intronic
990439515 5:55830696-55830718 GAGCTCCTGTTCCCAAGACCTGG + Intergenic
991410787 5:66343489-66343511 GAGCTTAATTTCCTTGTACCTGG + Intergenic
993170405 5:84412156-84412178 GAGGTTCATTTCCATATCCCTGG + Intergenic
995620453 5:114020502-114020524 GAGCACCATTTCCCTATCGGAGG + Intergenic
997984211 5:138490722-138490744 CAGCTCCATGTCCCCATTCCGGG + Intergenic
998133826 5:139664350-139664372 GGGCTCCATTTCCCTCTCCTGGG + Intronic
1003739427 6:8919149-8919171 CTTCTCCATTTCCCAATACCAGG - Intergenic
1004104418 6:12652697-12652719 GAGCTTCATTCACCTTTACCTGG + Intergenic
1004858395 6:19775448-19775470 GACTTACAGTTCCCTATACCTGG + Intergenic
1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG + Intronic
1007583160 6:42971531-42971553 GTGCTCCACTTCCCCAAACCAGG - Intronic
1010048101 6:71470794-71470816 GAGCCCCAACTCCCTATATCTGG + Intergenic
1012261142 6:97089123-97089145 CAACTCCATTTCCCTCTTCCAGG + Intronic
1013723874 6:113067800-113067822 GTGCTCTGTTTCCCTAGACCAGG + Intergenic
1018980873 6:168600666-168600688 GAGCTCCCTTTCCCAAAACCAGG - Intronic
1022337156 7:29432632-29432654 GTGATCCATTTCGCTGTACCTGG + Intronic
1023653995 7:42401644-42401666 GAGCTCCATTTCCATTCTCCTGG + Intergenic
1024455435 7:49600544-49600566 GAGCTCCAGTTCCCTTCACTGGG + Intergenic
1028817606 7:95165323-95165345 CAGCTACATTTCCCTAAAACTGG - Intronic
1032708965 7:134446307-134446329 GAGCTCCACTTCCCTCTTCAGGG + Intronic
1033641026 7:143263460-143263482 GAGCTCCTTTTCCCGGAACCCGG - Exonic
1035620094 8:1029949-1029971 GAGCTCCTCTTCCCTTAACCGGG - Intergenic
1036050824 8:5194810-5194832 CAGATGCATCTCCCTATACCTGG + Intergenic
1039344692 8:36690855-36690877 TAGCTCAATTTCAATATACCCGG - Intergenic
1041608398 8:59813416-59813438 GGGCTGACTTTCCCTATACCTGG - Intergenic
1041608453 8:59814218-59814240 GGGCTGACTTTCCCTATACCTGG - Intergenic
1042042041 8:64602364-64602386 GATCTGCATCTCCCTATTCCTGG - Intronic
1043138834 8:76562397-76562419 GAGCTGCATTCTCCTTTACCCGG - Intergenic
1048835238 8:138513016-138513038 GAGCTCCAGGTCCCTGTCCCCGG - Intergenic
1051405298 9:16730649-16730671 GAGCTCAGTTTGCCTATACTGGG - Intronic
1053426969 9:38016597-38016619 GCGTTCCATTTCCCCAGACCTGG + Intronic
1057696650 9:97327772-97327794 GAGCTCCCTTTCCCTGTCCAGGG - Intronic
1203660030 Un_KI270753v1:33012-33034 GAGCTGCTTTTCCCGATATCTGG + Intergenic
1187438473 X:19294579-19294601 GAGGTCCAGTTCCCTCTATCTGG + Intergenic
1189293233 X:39900760-39900782 CAGCTCCAGTTCCCTCAACCAGG + Intergenic
1191077857 X:56475108-56475130 ATGCTCCATTTCCCCATACCAGG - Intergenic
1196723816 X:118878331-118878353 GAGCTCCATTTCCACCTGCCGGG + Intergenic