ID: 981050430

View in Genome Browser
Species Human (GRCh38)
Location 4:140304377-140304399
Sequence TTCTAGTTAGATATCCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981050428_981050430 7 Left 981050428 4:140304347-140304369 CCACTGATTCTGGACATGTTGAT 0: 1
1: 0
2: 5
3: 15
4: 184
Right 981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG 0: 1
1: 1
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981050430 Original CRISPR TTCTAGTTAGATATCCTGGT AGG Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
911858160 1:102908876-102908898 GTCTAGTTAGAAATACTGGCAGG + Intronic
917037708 1:170767496-170767518 TTCCAAGTAAATATCCTGGTAGG + Intergenic
921464144 1:215465105-215465127 TTCTAGTTATTCATCATGGTGGG - Intergenic
922983027 1:229844574-229844596 TTCTAGGAAGATGTCCTGGATGG - Intergenic
1068853473 10:61771563-61771585 TTGTAGTAAGGTATCCTGGATGG + Intergenic
1071117053 10:82233734-82233756 TTCTGGTTTGACCTCCTGGTTGG - Intronic
1079962625 11:26942874-26942896 TTCTATTTAGACTTCCTTGTTGG - Intergenic
1081251565 11:40841795-40841817 TTCTATTTAGCAATCTTGGTTGG - Intronic
1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG + Intronic
1093102182 12:15040582-15040604 TTTTAGTGAGATATGCTGGGAGG + Intergenic
1093565901 12:20603279-20603301 TTCTATTTAGTCATCCTGGGAGG - Intronic
1097416104 12:59318285-59318307 TTCTATCTATATATCCTGTTAGG + Intergenic
1098516574 12:71384075-71384097 TTTTAGTTACAGTTCCTGGTTGG - Intronic
1099627605 12:85094826-85094848 TTCTGGTTAGATATATTGCTAGG + Intronic
1100488459 12:95054726-95054748 ATCTAGTTAGATATGTTGCTAGG - Intronic
1100979078 12:100150678-100150700 TTTTAGCTAGACATGCTGGTGGG - Intergenic
1104338863 12:127928468-127928490 TTCTGGTTAGATTTTCTGATTGG - Intergenic
1106872212 13:34033999-34034021 TTCTAGTTGGATATGGTGGAAGG - Intergenic
1115715964 14:36104130-36104152 TTCTAGCATGATATGCTGGTGGG + Intergenic
1116500031 14:45609457-45609479 CTCCAGTTAGATTTTCTGGTAGG + Intergenic
1116971708 14:51073132-51073154 TTCATTTTAGCTATCCTGGTGGG - Intronic
1117160902 14:52988572-52988594 TTCTAGGCAGATATATTGGTAGG + Intergenic
1120317582 14:82915736-82915758 TTGAAGTTAGATAGCCTGGTGGG - Intergenic
1125433652 15:39624019-39624041 TTCAAGCAAGATAACCTGGTTGG + Intronic
1128404118 15:67317643-67317665 CTCTTGTTAGATCTCCTGGAAGG + Intronic
1131879380 15:96846274-96846296 TTCTAGGTAGATAGCCAGGGTGG + Intergenic
1135566648 16:23516362-23516384 TCCTAGATATATATCCTGTTGGG + Intronic
1144245901 17:13364303-13364325 TTCAAGTTAGATTTCCTGTTGGG + Intergenic
1153162354 18:2221837-2221859 TTCTAGTTTTATATCCAGGATGG - Intergenic
1157734014 18:50030570-50030592 TTCTAGTTAGTGGTCCTGGTTGG - Intronic
1158244522 18:55416392-55416414 TTCAAGCTAGAAAGCCTGGTAGG + Intronic
1160614745 18:80116554-80116576 TTCTTTATAGATATCCTGGTGGG + Intronic
1162883393 19:13677577-13677599 TTCTTTTTATTTATCCTGGTTGG - Intergenic
1163982964 19:20918816-20918838 ATCTATTTAGATATCCAGTTAGG - Intergenic
1164049528 19:21572698-21572720 GTCTATTTACATATCCAGGTAGG + Intergenic
1165531777 19:36408887-36408909 TTATACTTAGATATTTTGGTTGG + Intronic
935497433 2:103798170-103798192 TTTTAGTTACATACCCTGGAAGG + Intergenic
938749310 2:134313662-134313684 TTCAAGTTACATATCTTGGCAGG + Intronic
938872884 2:135499663-135499685 TTCATTTTAGATATTCTGGTAGG - Intronic
940118596 2:150238090-150238112 TTCAAGGTACATATTCTGGTTGG + Intergenic
940225075 2:151392700-151392722 CTCTAGTGAGCTGTCCTGGTTGG - Intergenic
940231941 2:151464116-151464138 TTCTAGTTTGATACCGTGTTCGG - Exonic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
944309592 2:198218603-198218625 TTCTAGAGAGATAGCCTGATAGG + Intronic
944423001 2:199551032-199551054 TTCTTGTAAGATTTCCTGGCCGG + Intergenic
944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG + Intergenic
946118083 2:217481502-217481524 TTCTAGTTAGATATCATACATGG - Intronic
946919312 2:224561693-224561715 TTTTAATCAGATATCCTGATAGG + Intronic
1177944989 21:27456501-27456523 TACTAATAAGATATCCTGGCCGG - Intergenic
950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG + Intergenic
951786159 3:26421531-26421553 TTCTAGCCTGATATCCTGGTGGG + Intergenic
956711985 3:72047163-72047185 TTCTAGTTAAAGATCCAGCTGGG - Intergenic
959651524 3:108755699-108755721 TTTGAGTTAGATTTCTTGGTTGG + Exonic
959729074 3:109580257-109580279 ATCTAGTGAAATATCCTGGCAGG - Intergenic
962558328 3:136578956-136578978 TTCTAGTTTATTATCTTGGTAGG - Intronic
965958991 3:174406348-174406370 TTCTGGTGAGATTCCCTGGTTGG + Intergenic
967392588 3:188971844-188971866 TTGAAGTTAGATATGCTGATTGG + Intronic
970531081 4:16984991-16985013 TTCTATTTAAAAATCCTGGTGGG - Intergenic
976055774 4:81064238-81064260 ATCTAGGTAGATATGCAGGTAGG + Intergenic
976912994 4:90331561-90331583 TTCTAGTAAGGTGTCCTTGTGGG - Intronic
978349561 4:107807564-107807586 CTCAATTTAGATATCCTGGTGGG - Intergenic
980619925 4:135287665-135287687 TTCTAGATGGATATCATGGTAGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
984135808 4:175936652-175936674 TTCTGGTTTGATATCTTGTTAGG - Intronic
984366550 4:178806266-178806288 TTCTTGTTAGATTTCCAGCTTGG - Intergenic
984836458 4:184026661-184026683 TTATAGTATGGTATCCTGGTTGG - Intergenic
993818371 5:92581776-92581798 TTCTGGTTAGCTATCCTCCTAGG - Intergenic
996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG + Intronic
996446330 5:123556264-123556286 TTCTTTTTAGTTATCCTGTTTGG + Intronic
1000142316 5:158417405-158417427 TTCTGGTTGGACATCTTGGTGGG + Intergenic
1003764505 6:9220051-9220073 TTCTAGTTCTATATCCTTGAGGG - Intergenic
1010806979 6:80248859-80248881 CTATAGATAGATACCCTGGTTGG + Intronic
1011370618 6:86633460-86633482 TTGTAGTCAGAGACCCTGGTAGG + Intergenic
1012612408 6:101231800-101231822 CTCTAGGTTGCTATCCTGGTAGG - Intergenic
1013676309 6:112466927-112466949 GTCTATTTATATATCCTGTTAGG - Intergenic
1016337581 6:143024192-143024214 TTCCAGACAGATTTCCTGGTGGG - Intergenic
1018609080 6:165629257-165629279 TTCTTCTTAGATATCCCAGTGGG + Intronic
1024014748 7:45303059-45303081 TTCTAATTAGCTATCCTAGTGGG - Intergenic
1027381513 7:77614917-77614939 TTTTAGTTTGATATACTAGTTGG + Intronic
1033391162 7:140928795-140928817 TTCGAGATAGAAATGCTGGTAGG - Intergenic
1034817877 7:154189215-154189237 TTCTACTAAACTATCCTGGTTGG - Intronic
1035880245 8:3238734-3238756 CTCTAATTAGATGTCCTGGGTGG - Intronic
1038740867 8:30215511-30215533 TTCTAGTAGAATATCCTTGTAGG + Intergenic
1046207751 8:111024216-111024238 TTCTAAGTAGATATTCTGGATGG + Intergenic
1053286579 9:36853329-36853351 TTCTATTAATATATCTTGGTAGG - Intronic
1056948805 9:91025477-91025499 TTCATATTAGATATCCTGTTGGG + Intergenic
1057319551 9:93999975-93999997 TTCTGGTTTACTATCCTGGTAGG + Intergenic
1057326904 9:94073919-94073941 TTCTAGTTTGATTTCATTGTGGG + Intronic
1058196125 9:101978658-101978680 TTATATTGAGATATCCAGGTGGG - Intergenic
1059874279 9:118616754-118616776 TTCTATTTAGGTAACCTGGGGGG + Intergenic
1189085515 X:38019109-38019131 TATAAGTTAGATTTCCTGGTAGG - Intronic
1190402021 X:50046595-50046617 ATCTAGTTAGAAATCTAGGTGGG + Intronic
1190806800 X:53845442-53845464 TCCTATTTAAATATCCTGGTGGG + Intergenic