ID: 981051042

View in Genome Browser
Species Human (GRCh38)
Location 4:140309813-140309835
Sequence GCCATGAGCTGTGGGGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981051042_981051048 22 Left 981051042 4:140309813-140309835 CCCCAAACCCCACAGCTCATGGC 0: 1
1: 0
2: 2
3: 37
4: 471
Right 981051048 4:140309858-140309880 TCTTTCAAAATCTCCAGCCTAGG 0: 1
1: 0
2: 0
3: 23
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981051042 Original CRISPR GCCATGAGCTGTGGGGTTTG GGG (reversed) Intronic
900832809 1:4977278-4977300 GTTCTGAGCTGTGGGGTGTGGGG + Intergenic
900886269 1:5417791-5417813 GGCATGGGCTTTGGGGTTAGTGG - Intergenic
901034931 1:6330748-6330770 GCCAAGAGCTGTTGGGTTTTTGG - Intronic
901380699 1:8871863-8871885 GCCATGGGCTGTGGGTTCTAAGG + Intronic
902120391 1:14160029-14160051 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
902626829 1:17681610-17681632 GCCAGGTGCTGTGGGGCTGGGGG + Intronic
902840636 1:19071837-19071859 GTCAGGAGCTGAGGGGTCTGCGG - Intergenic
903817419 1:26074945-26074967 TACATGAGCTGTGGGTCTTGGGG - Intergenic
904366739 1:30015935-30015957 CCCATGAGCTGGGTGGTGTGGGG - Intergenic
904374568 1:30072218-30072240 GCTCTGAGCTGTGGGACTTGGGG - Intergenic
904498563 1:30901253-30901275 GCCATCAGCTGTGGGATGTCAGG + Intronic
905636784 1:39559358-39559380 GACCAGAGCTGTGGAGTTTGTGG + Intergenic
906379045 1:45319993-45320015 GCCTTGAGCAATGGGGTCTGAGG - Intergenic
907482993 1:54757621-54757643 TCCATGAGCTGTGCTGTTTCTGG + Exonic
908124049 1:61012998-61013020 GCCACTAGCTATGGGGGTTGGGG - Intronic
909369191 1:74864097-74864119 TCCATCAGGTCTGGGGTTTGGGG + Intergenic
909462763 1:75937803-75937825 GCCAGGGGCTGTGGGGATGGAGG - Intergenic
910864878 1:91779399-91779421 CTCATGAGCTGTGGGGCTTTGGG - Intronic
911150385 1:94592507-94592529 GCTATGAGATGTGGGGCTGGGGG - Intergenic
911170639 1:94767713-94767735 GGCAAGAGCTATGGGCTTTGAGG - Intergenic
911893796 1:103404018-103404040 CCCATGACATGTGGGATTTGTGG + Intergenic
912058651 1:105636508-105636530 GCCCTGAGCTGTGTCGATTGTGG - Intergenic
912102759 1:106232517-106232539 GCCATGAGCTGTGCTGCCTGGGG + Intergenic
912638720 1:111323058-111323080 GACATCAGCTGTTGGCTTTGAGG + Intergenic
914698464 1:150107941-150107963 CCCATGACCTGTGAGATTTGAGG + Intronic
914783799 1:150809833-150809855 ACCATGAGGTGGGGGTTTTGGGG - Exonic
915538518 1:156552453-156552475 GATGTGAGCTGTTGGGTTTGAGG - Intronic
917061773 1:171049089-171049111 GCCATGAGCTGTGTAGTCTGGGG + Intronic
917532651 1:175850827-175850849 ACCAGGAGCTGTGGGGGATGAGG + Intergenic
917674990 1:177310375-177310397 GCAATGTGCTCTGGGGTGTGGGG - Intergenic
918401309 1:184165153-184165175 GCCAGGAGCTGTGGGGCTGTGGG + Intergenic
918825635 1:189320225-189320247 GCCAGGAGCTGTTGGGAGTGAGG + Intergenic
919212854 1:194510598-194510620 TCCATGAGGTGTTGGGCTTGTGG + Intergenic
919744298 1:200999319-200999341 GGCCTGAGCTGTGGGCTGTGGGG - Intronic
920594991 1:207259937-207259959 GCCACGAGCTGTGCTGTCTGAGG + Intergenic
921231950 1:213082072-213082094 GAAATGAGCTATGGGCTTTGAGG + Intronic
921480818 1:215662739-215662761 ACCTTGAGCTGTGGGAGTTGGGG + Intronic
922789983 1:228306088-228306110 GCCCTGGGCTCTGGGGTGTGTGG + Intronic
923368553 1:233287386-233287408 GCCATGAGCTGTGGGAATTATGG - Intronic
924142408 1:241039286-241039308 GGCATGAGGTGTGGGTTGTGAGG + Intronic
924438585 1:244067723-244067745 TCCAGGAGCAGTGAGGTTTGGGG + Intergenic
924768287 1:247054360-247054382 GCCATGAGCTGTGCTGTTTGAGG - Intronic
924888034 1:248241191-248241213 GCCATGAGCTGTGCAGCCTGAGG - Intergenic
1063299121 10:4835911-4835933 TACCTGAGATGTGGGGTTTGTGG + Intronic
1064939093 10:20712963-20712985 GCCATGATGTGGGGGGTTGGGGG - Intergenic
1065160569 10:22916887-22916909 GCCTTGAGCTGAGGAGTTGGAGG - Intergenic
1065176242 10:23078723-23078745 ACAATGTGCTGTGGGGTTTATGG + Intergenic
1065505807 10:26429075-26429097 CCCATGACATGTGGGGATTGTGG + Intergenic
1065843633 10:29726789-29726811 GCCCTGTGCTGAGGGCTTTGAGG - Intronic
1066461869 10:35619432-35619454 GCCATGATATGTGGGGATTATGG - Intergenic
1067144857 10:43687626-43687648 GGCTTGAGCTGGGGAGTTTGGGG + Intergenic
1067147878 10:43706621-43706643 GGAATTAGCTGTGGGATTTGAGG + Intergenic
1068335675 10:55630449-55630471 GACATGGGAAGTGGGGTTTGGGG - Intergenic
1069182684 10:65382692-65382714 GCCATGAGTTTTGCAGTTTGAGG - Intergenic
1069933657 10:71900498-71900520 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
1070270573 10:74950742-74950764 GCCATCAGTTGTGAAGTTTGTGG + Intronic
1072083547 10:92056780-92056802 GCCATGAGCTGTGCAGCCTGGGG - Intronic
1073485727 10:103817899-103817921 GCCGAGAGCTGTGGGGTGGGTGG + Intronic
1073487278 10:103827467-103827489 CCCATGAGCTGTGTGGTGTTGGG + Intronic
1073708249 10:106011133-106011155 GCCATAAGCTGTGCAGTCTGGGG + Intergenic
1074011049 10:109480529-109480551 GCCATGACATGTGGGAATTGTGG - Intergenic
1074424603 10:113339824-113339846 GCCATGAAATTTGGGGTTTTAGG + Intergenic
1074824939 10:117207966-117207988 CACCTGCGCTGTGGGGTTTGAGG + Intronic
1075383733 10:122039524-122039546 GGCCTGAGATGTGGGGTTGGGGG + Intronic
1076209133 10:128626536-128626558 GGCATGTGCTGTTGAGTTTGGGG + Intergenic
1076943221 10:133623833-133623855 GACAAGAGCTGTGGGCTGTGGGG + Intergenic
1077286229 11:1767223-1767245 GCAGCGAGCTGTGGGGTGTGTGG + Intergenic
1077295063 11:1822707-1822729 GGCGTGAGGTGTGGGGTGTGGGG - Intergenic
1077532039 11:3101875-3101897 GGCCTCAGCTGTGGGGCTTGCGG + Intronic
1077578877 11:3404434-3404456 GCCATGTGCTCTGGGGGCTGTGG + Intergenic
1077578891 11:3404483-3404505 GCCATGTGCTCTGGGGGCTGTGG + Intergenic
1078576891 11:12510165-12510187 CCCTTGGGCTGTGGGGTTTTAGG - Intronic
1079182098 11:18202707-18202729 GCCATGATATGTGGGAATTGTGG + Intronic
1080771190 11:35343483-35343505 GTCATGCCCAGTGGGGTTTGCGG - Intronic
1082029884 11:47596136-47596158 GCCATGAGCTGGTGGGTGTAAGG + Intergenic
1083172627 11:60931938-60931960 CCCATGAGCTGAGGGGCCTGGGG + Intronic
1083202794 11:61130672-61130694 CCCCTGCACTGTGGGGTTTGGGG - Exonic
1083360531 11:62104343-62104365 CCCATGACATGTGGGGATTGTGG - Intergenic
1083419342 11:62544581-62544603 GCTCTGAGCTGTGAGCTTTGGGG - Intronic
1083893730 11:65609957-65609979 GCCAGGGGCTGTGGGGGCTGAGG - Intronic
1084187825 11:67484183-67484205 CCCATGTGCTGGGGGGTTGGTGG + Intronic
1084235913 11:67788002-67788024 GCCATGTGCTCTGGGGGCTGTGG + Intergenic
1084436148 11:69141782-69141804 CCCATGACCTGTGGGGATTATGG - Intergenic
1085182470 11:74547262-74547284 CCCTTGAGCCGTGGAGTTTGAGG + Intronic
1087532993 11:99407496-99407518 GCCGTGAGCTGTGCAGTTTGAGG + Intronic
1089113364 11:116074269-116074291 GCCCTCAGCTGTGGGGGTGGGGG + Intergenic
1089164520 11:116464886-116464908 ACTATTAGCTGTGGGTTTTGTGG - Intergenic
1089736321 11:120552437-120552459 GCAATGAGCTGAGGGTGTTGGGG + Intronic
1090091329 11:123701093-123701115 GTCCTGAACTGTGTGGTTTGAGG + Intergenic
1090412650 11:126519801-126519823 GCCATGTGGTGTGGGGGTTGTGG - Intronic
1090649761 11:128796036-128796058 GTTATGAGCTGTGTGGTCTGAGG - Intronic
1091774996 12:3178793-3178815 GCCCTTGGCTGTGTGGTTTGAGG + Intronic
1091807104 12:3364762-3364784 GCCTGGAGCTGTTTGGTTTGTGG - Intergenic
1092004761 12:5060100-5060122 GCTACTAGCTGTGTGGTTTGAGG - Intergenic
1093903391 12:24661666-24661688 GCCATGAGCTGTGCTGCCTGGGG + Intergenic
1094185495 12:27638041-27638063 GCCAGGAGCTGAGGGGAGTGGGG + Intronic
1094486285 12:30928019-30928041 GCCCAGAGCTGTTTGGTTTGTGG + Intronic
1095573680 12:43710415-43710437 GCCATGAGCTGTGCAGCCTGAGG + Intergenic
1095737806 12:45576716-45576738 GCCTTGAGCTGTGGGCCTGGAGG + Intergenic
1095902574 12:47343216-47343238 GCCATGGGGTGGGGGGTTGGGGG + Intergenic
1096448664 12:51718400-51718422 GCCTTGAGCCCAGGGGTTTGAGG + Intronic
1097745865 12:63302509-63302531 TCCCTGAGCTGTGGTGGTTGTGG - Intergenic
1098467196 12:70800967-70800989 ACCATGTGTGGTGGGGTTTGTGG - Intronic
1100360887 12:93878428-93878450 GCCATGAGCTGTGTAGCCTGGGG + Intronic
1100435069 12:94563682-94563704 GCCATGAGCTGACAGATTTGTGG - Intergenic
1101423261 12:104566495-104566517 GCCAGGACCTGTGGGGATGGAGG - Intronic
1101705960 12:107221588-107221610 GCCAGGCGCCGTGGGGGTTGGGG + Intergenic
1102008109 12:109601575-109601597 GACATGAGGTGTGAGGTGTGAGG - Intergenic
1102017582 12:109657831-109657853 TCCATCAGATGTGGGGTGTGAGG + Intergenic
1102031938 12:109744614-109744636 CCCATGAGCTGTGTGGTCTTGGG + Intronic
1103127116 12:118433296-118433318 AACATGAGCTGTGTGTTTTGTGG - Intergenic
1103170846 12:118818435-118818457 GCCATGAGATGTGTGGAATGGGG + Intergenic
1103735759 12:123059798-123059820 GCCAGGAGCTGTGGGGAGGGAGG + Intronic
1104043759 12:125147135-125147157 GCTATGTTCTTTGGGGTTTGGGG - Intergenic
1104257955 12:127156287-127156309 ACCTTGAGCAGTGGGGTCTGAGG - Intergenic
1104590125 12:130077665-130077687 CCCATGACATGTGGGGATTGTGG + Intergenic
1104709837 12:130977732-130977754 GCCTTCAGCTGTGTGGTCTGTGG + Intronic
1105703911 13:22956915-22956937 GCCATGAGCAGTGCGGTGTCAGG - Intergenic
1107029254 13:35834116-35834138 CCCCTGAGCTGTGGGGTGTCTGG - Intronic
1107851828 13:44578032-44578054 GCCGGGAGCTGTGGGGTCTATGG + Intergenic
1108137887 13:47385389-47385411 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
1108598202 13:51968124-51968146 GCCCTGAGCTGGGTGGTTAGGGG - Intronic
1108633242 13:52307652-52307674 CCAATGAGCTGGTGGGTTTGGGG + Intergenic
1108653448 13:52504910-52504932 CCAATGAGCTGGTGGGTTTGGGG - Intergenic
1110565082 13:76949712-76949734 GCCCCCAGCTGTGGGGTTTGTGG + Intronic
1111365283 13:87234963-87234985 GCCATGAGCTGTGCTGCTTGGGG + Intergenic
1111396755 13:87675762-87675784 TCCATGGGCTACGGGGTTTGAGG + Exonic
1112699886 13:101995310-101995332 GCCATGACCTTTTGGGTTTAGGG - Intronic
1112700718 13:102004706-102004728 CCCATGACCTGTGGGGATTATGG - Intronic
1113225784 13:108158437-108158459 CCCATGACCTGTGGGGATTATGG + Intergenic
1113329718 13:109316553-109316575 CCCATGACATGTGGGGATTGTGG + Intergenic
1113457642 13:110459913-110459935 GCCATGAGCTGATGTGTGTGGGG - Intronic
1114364332 14:22010918-22010940 GCTCTGAGATGTGGGGTATGAGG - Intergenic
1114598135 14:23931807-23931829 TCCATGGACTGTGGGGTTTGCGG - Intergenic
1114989642 14:28271569-28271591 CCCATGACATGTGGGGATTGTGG + Intergenic
1116020760 14:39457504-39457526 CCCATGACATGTGGGGATTGTGG + Intergenic
1116725217 14:48554357-48554379 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
1117838969 14:59837911-59837933 GCCTTGATTTGGGGGGTTTGGGG + Intronic
1119454152 14:74739992-74740014 GCCAGTGGCTGTGGGGATTGGGG + Intergenic
1119887076 14:78152146-78152168 GGTATGAGTTGTGGGGTGTGTGG + Intergenic
1121254187 14:92519483-92519505 GCCATCAGCTGTGGGAGCTGTGG + Intronic
1121375886 14:93410515-93410537 GCCATGAGCTGTGCAGGCTGGGG - Intronic
1121421880 14:93821747-93821769 CCCATGACCTGTGGGGATTATGG - Intergenic
1121475013 14:94191201-94191223 GAAATGTGCTGTGGGGTGTGAGG + Intronic
1122663379 14:103312406-103312428 GGCATGAGCTGTGGTGTCGGTGG - Intergenic
1123499559 15:20867306-20867328 GCCAACAGCTGTGGGGCTTCTGG + Intergenic
1123556811 15:21441036-21441058 GCCAACAGCTGTGGGGCTTCTGG + Intergenic
1123593034 15:21878272-21878294 GCCAACAGCTGTGGGGCTTCTGG + Intergenic
1124992495 15:34689855-34689877 CCCATGACATGTGGGGTTTATGG - Intergenic
1125727860 15:41877236-41877258 GCCAGGAGCTGAAGGTTTTGTGG - Exonic
1126009416 15:44288730-44288752 ACCGTGAGGTGTTGGGTTTGGGG + Exonic
1132214335 15:100051535-100051557 TCCATGACCTGTTGGGTGTGGGG - Intronic
1202965154 15_KI270727v1_random:168225-168247 GCCAACAGCTGTGGGGCTTCTGG + Intergenic
1132579800 16:679773-679795 CCCACGCGCTGTGGGGTGTGAGG - Intronic
1133039514 16:3052888-3052910 GCCATGTGCTGAGGGGAATGGGG + Intronic
1133043357 16:3072521-3072543 GCCATGTGCTGAGGGGAATGGGG + Intronic
1133305253 16:4804351-4804373 GCCAAGAGGAGTGGGGGTTGGGG - Exonic
1133798552 16:9066283-9066305 CCCTTCATCTGTGGGGTTTGAGG + Intergenic
1135789610 16:25381680-25381702 GGCTTGAGCTCTGGAGTTTGAGG - Intergenic
1135789787 16:25383320-25383342 GGCTTGAGCTCTGGAGTTTGAGG - Intergenic
1136273011 16:29159401-29159423 ACCATGAACGGTGGGGTTGGTGG + Intergenic
1136393909 16:29982668-29982690 GCCAAGGGCTGTGGGTTGTGGGG + Intronic
1136530543 16:30865492-30865514 CCCTTGAGCTCTGGAGTTTGAGG + Intronic
1137837463 16:51606574-51606596 GCCCTGAGCTCAGGAGTTTGAGG + Intergenic
1137928203 16:52562015-52562037 GACAGTAGCAGTGGGGTTTGTGG + Intergenic
1138491775 16:57381282-57381304 GCTCTGAGCTGTGGGCTTGGTGG + Intronic
1139429025 16:66901196-66901218 GCTGTTTGCTGTGGGGTTTGAGG - Intergenic
1140615477 16:76657707-76657729 CCCATGAGCTGTTGGGTTGAGGG - Intergenic
1141638159 16:85326440-85326462 CCCAGGACCTGTGGGGTTTGTGG - Intergenic
1143048222 17:4100198-4100220 GGCCAGAGCTGTTGGGTTTGGGG - Intronic
1143479449 17:7220107-7220129 GCCGCGAGCTGTGGGGAGTGGGG - Exonic
1143642129 17:8205156-8205178 GCCAGGAGCTGGGGGGCTGGGGG - Intronic
1144260315 17:13512399-13512421 GCCAAGGGCTGAGGGGTGTGGGG + Intronic
1144395566 17:14839485-14839507 CCCATGACCTGTGGGGATTATGG - Intergenic
1144789455 17:17849365-17849387 GCCCTGTGCTGTGGGCTTTGTGG - Intronic
1144864173 17:18324243-18324265 GCCGTGAGCTGTGGTGACTGAGG - Intergenic
1145940544 17:28741268-28741290 GCCATGAGCAGTGGGGGGTGGGG + Intronic
1147166500 17:38596255-38596277 GCCATGGGCCATGGGGTTGGGGG + Intronic
1147166757 17:38597615-38597637 GTCATTTGCTGTGTGGTTTGGGG - Intronic
1147722078 17:42545617-42545639 GCGCTGAGGCGTGGGGTTTGGGG - Intergenic
1149157412 17:53648191-53648213 GCCATGAGTTGTGCAGCTTGGGG + Intergenic
1149680961 17:58506975-58506997 GTCAGAAGCTGTGGGGTATGAGG - Intronic
1149735942 17:58993617-58993639 GCCAGGAGCTGTGGGGAAGGGGG + Intronic
1150353786 17:64466244-64466266 CCCATGAGATGTGGGGATTATGG + Intronic
1150649797 17:67002336-67002358 CCCATGAGATGTGGGGATTATGG + Intronic
1150981065 17:70142240-70142262 TTAATGAGCTGTGGGTTTTGGGG + Intergenic
1151508844 17:74546071-74546093 GCCAGAAGCTGTGGGCTGTGGGG - Exonic
1151705331 17:75764318-75764340 GCCCTGAGCTGTGGGGCAAGGGG + Intronic
1152024852 17:77802417-77802439 GCAATGAGGTGTGGGGTGTGGGG - Intergenic
1152154827 17:78626036-78626058 GGCATGAGCTCTGAGGTTTCAGG + Intergenic
1152533739 17:80938140-80938162 GACAGGAGCTGAGGGGTTTCAGG - Intronic
1153443080 18:5142388-5142410 GCCTTGACATGTGGGGATTGTGG + Intergenic
1153578684 18:6549629-6549651 GACATGAGATGTGGGGTGGGAGG - Intronic
1153881346 18:9424263-9424285 GCCTTGAGCAGTGGGGTCTGAGG + Intergenic
1154457618 18:14544181-14544203 GCCAACAGCTGTGGGGCTTCTGG + Intergenic
1155691313 18:28627737-28627759 ACCAGGAGCTCTGGAGTTTGAGG - Intergenic
1156397819 18:36715173-36715195 CCCATGACCTGTGGGGATTATGG - Intronic
1158576493 18:58643081-58643103 GCCTTGAGCAATGGGGTCTGAGG + Intergenic
1159877425 18:73827978-73828000 GCCATGAGCAGAGGGCTATGTGG - Intergenic
1160438710 18:78871954-78871976 GCCATGATTTATGGGATTTGTGG - Intergenic
1160578805 18:79872027-79872049 GCCAAGGGCTGAGGGGTGTGCGG - Intronic
1161537727 19:4830710-4830732 GCCATGAGCCGGGGGCTGTGTGG + Intronic
1162546779 19:11335593-11335615 GCCATGAGCCGGGGGGGTTAGGG + Intronic
1162558790 19:11403745-11403767 CCCATGAGAGGTGGGGCTTGTGG + Intronic
1163279078 19:16304176-16304198 GACAGGAATTGTGGGGTTTGGGG - Intergenic
1164220363 19:23187792-23187814 GCCTTGAGCAATGGGGTCTGAGG - Intergenic
1164873041 19:31662550-31662572 GCCGTGAGTTGTGGGGGTTGGGG + Intergenic
1165528760 19:36379063-36379085 GGCAGTAGCTGTGGAGTTTGTGG - Intronic
1166217256 19:41343760-41343782 GCCATGTGCTGGGTGGTGTGGGG - Intronic
1166337462 19:42116998-42117020 GCCGTGAGCTGCGGGGTGTCGGG + Intronic
1167096079 19:47375715-47375737 GCCATGGGCTGTGGGGTGTGGGG + Intronic
1167505902 19:49870968-49870990 GGAAGGAGCTGTGGGCTTTGAGG - Intronic
925038248 2:708829-708851 GCCACGGGCTGGGGGATTTGAGG + Intergenic
925223314 2:2160508-2160530 GCCATGAGGTGAGAGGGTTGAGG + Intronic
925969310 2:9095904-9095926 TCAATGAGCTGTGGGCTTTTTGG - Intergenic
926151564 2:10428432-10428454 GCCATGAGATGTGGGGCTGGTGG - Intergenic
926165827 2:10521804-10521826 GTCAGGAGTTGTGGGGCTTGAGG + Intergenic
926886431 2:17602894-17602916 GCCAAGAGCTATGGAGTGTGTGG + Intronic
927514345 2:23663153-23663175 GTCCTCAGCTGCGGGGTTTGGGG - Intronic
928086530 2:28349757-28349779 GCCATGAGCTGTGGACATGGCGG + Intergenic
928204661 2:29275349-29275371 GCCATGGGCCATGGGGGTTGGGG + Intronic
928458817 2:31450544-31450566 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
929223930 2:39493756-39493778 GCCATGAGCTGGAGGGATAGAGG - Intergenic
929383908 2:41382654-41382676 GCCTTGAGCAATGGGGTCTGAGG - Intergenic
929439519 2:41954216-41954238 GCCACAGGCTGTGGAGTTTGGGG + Intronic
929606591 2:43238879-43238901 GCCAAGAGCTGTGGGAGCTGGGG + Intronic
930238383 2:48909526-48909548 GCCTAAAGCTGTGGGGTTTGGGG + Intergenic
930812127 2:55553613-55553635 GCCAAGAGCTGGGTGGTGTGGGG - Intronic
931363733 2:61600600-61600622 GCCATGAGCTAGGGAGTGTGAGG + Intergenic
931910344 2:66892336-66892358 TAGATGAGCCGTGGGGTTTGAGG - Intergenic
932858845 2:75267327-75267349 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
935124460 2:100211361-100211383 GTCTTGAGCTGTTAGGTTTGTGG - Intergenic
937521030 2:122712400-122712422 GTAATGAGCAGTGGGGTATGTGG - Intergenic
937552235 2:123108252-123108274 GCCATGAGCTGTGTAGTTTTGGG + Intergenic
937594662 2:123659325-123659347 GCCTTGAGCCATGGGGTTTGAGG + Intergenic
938473935 2:131590539-131590561 GCCAACAGCTGTGGGGCTTCTGG - Intergenic
938976090 2:136480135-136480157 GCCAGAAGCTGTGGGGACTGTGG + Intergenic
941529135 2:166643138-166643160 GCCTCGGGCTGTGGGATTTGTGG - Intergenic
941848829 2:170158860-170158882 GCAATGAGCTGTGAGGATTGAGG + Intergenic
942009108 2:171740961-171740983 TCCAGGAGCTGTGGGGGTAGGGG - Intronic
942773285 2:179548816-179548838 TCCATGACATGTGGGGATTGTGG + Intronic
943619411 2:190131376-190131398 TCCCTGAACTATGGGGTTTGGGG + Intronic
943926940 2:193796377-193796399 CCCATGACCTGTGGGGATTATGG + Intergenic
943960944 2:194263170-194263192 GCCATGGGAGGTGGGGATTGGGG - Intergenic
944790050 2:203115707-203115729 GGCATGAGCTGTGGGATTACAGG + Intronic
945858486 2:215094306-215094328 GCCCTGAGCAATGGGGTCTGAGG - Intronic
946616780 2:221518377-221518399 GTCATGAACTGTGTGTTTTGAGG + Intronic
946693166 2:222325305-222325327 CCCTTGAGCTGTAGAGTTTGAGG + Intergenic
947533594 2:230927640-230927662 GCCCCGAGTTGGGGGGTTTGGGG + Intronic
947598780 2:231431631-231431653 ACCTTGAGCAGTGGGGTCTGAGG + Intergenic
948321967 2:237076945-237076967 GCCATGGGCTGGGATGTTTGGGG - Intergenic
948535847 2:238646187-238646209 GCCAGGGTCTGTGGGGGTTGAGG - Intergenic
1168942111 20:1721507-1721529 GCCGTGAGCTTTGGTGTTTGTGG - Intergenic
1169251298 20:4063404-4063426 GCCTTGAACTCTGGGGATTGGGG + Intergenic
1169383011 20:5125295-5125317 GACCTGAGCTGTGAGTTTTGGGG - Intronic
1169936747 20:10891820-10891842 ACCATGAGCTGTGGGGCTACAGG + Intergenic
1170574618 20:17652973-17652995 GCCATGAGCTGTGGTGCCCGAGG - Intronic
1170591642 20:17776111-17776133 GCCATGGGCTGAGGGTTGTGGGG - Intergenic
1171024533 20:21616890-21616912 GCGGTGGGCTGTGGAGTTTGTGG + Intergenic
1171319850 20:24233041-24233063 GCCATGAGCTCAGGAGTCTGAGG - Intergenic
1172219450 20:33263423-33263445 CCCATGATCTGTGGGGATTATGG - Intergenic
1173623059 20:44451140-44451162 GCCATGAACTGTCGGGCTTCAGG - Intergenic
1173922468 20:46756849-46756871 TCCTTGAGCTGTAGGCTTTGGGG + Intergenic
1174332617 20:49831984-49832006 GCCAAGAGGAGTGGGGTTGGGGG + Intronic
1174407446 20:50311412-50311434 GCCCGGTGCTGAGGGGTTTGGGG + Intergenic
1174690984 20:52504173-52504195 GCCATGAGCTGTGCTGCCTGGGG - Intergenic
1175408478 20:58750809-58750831 CCCATGACCTGTGGGAGTTGTGG - Intergenic
1175436887 20:58959118-58959140 GCTAGTAGCTGTGGGGATTGGGG - Intergenic
1175898398 20:62350343-62350365 GCCAGGAGCTGTGGGCCCTGGGG - Intronic
1176108126 20:63399100-63399122 GCCACCAGCTGGGGGGTGTGGGG + Intergenic
1176198150 20:63847505-63847527 ACCACCAGCTGTGGGGCTTGTGG + Intergenic
1176816539 21:13609157-13609179 GCCAACAGCTGTGGGGCTTCTGG - Intergenic
1177439296 21:21099618-21099640 TCCATGACATGTGGGGATTGTGG + Intronic
1178145045 21:29729385-29729407 GCCCTGAGCAGTGGATTTTGGGG - Intronic
1178398220 21:32261141-32261163 GCCATGGGGCCTGGGGTTTGTGG - Intergenic
1178893517 21:36540583-36540605 GCCAGGACCAGGGGGGTTTGAGG + Intronic
1180785035 22:18542432-18542454 GCCCTGAGAGGTGGGCTTTGAGG + Intergenic
1181128618 22:20716465-20716487 GCCCTGAGAGGTGGGCTTTGAGG + Intronic
1181241938 22:21481786-21481808 GCCCTGAGAGGTGGGCTTTGAGG + Intergenic
1181415637 22:22756795-22756817 GCCAGGCACTGTGGGGTCTGAGG + Intronic
1181596398 22:23917671-23917693 CCCATGAGCTTAGGCGTTTGAGG + Intergenic
1181920967 22:26320246-26320268 GCCAAGTGCCGTGGGGCTTGGGG + Intronic
1183275486 22:36894485-36894507 GCTGTGAGCTGTGAGGTTGGAGG + Intergenic
1183544540 22:38448592-38448614 CCCCAGAGCTGTGGGGTCTGTGG - Intronic
1184367556 22:44062243-44062265 GCCCTCACCTGTGGGGTCTGAGG - Intronic
1184854889 22:47141248-47141270 CCCATGACATGTGGGGATTGTGG + Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185269571 22:49922844-49922866 GGCGTGAGGTGTGGGGCTTGGGG + Intronic
1185343852 22:50302975-50302997 GCCATGGAGAGTGGGGTTTGAGG - Intronic
1185420707 22:50732663-50732685 GCGATGACCTGTGGGGTGGGGGG + Intergenic
949403335 3:3688480-3688502 GCCATGATGTGAAGGGTTTGGGG - Intergenic
950171099 3:10839569-10839591 GCCTTGAGATGTTGGGGTTGTGG + Intronic
950305535 3:11913153-11913175 ACCATGAGCTGGGTGGTTTGGGG - Intergenic
950413370 3:12853683-12853705 GCAAGGAGTTGTGCGGTTTGGGG + Intronic
950414273 3:12859703-12859725 ACCATGAGCTGGGTTGTTTGGGG - Intronic
950414551 3:12861446-12861468 ACCATGAGCTGGGTTGTTTGGGG - Intronic
951423060 3:22510463-22510485 GCCATGAGCTGTGTAGCCTGAGG - Intergenic
952188032 3:30992238-30992260 CCCATGACATGTGGGGTTTATGG + Intergenic
953722511 3:45368806-45368828 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
953769495 3:45768525-45768547 GCCTTGAGGGCTGGGGTTTGTGG + Intronic
954143850 3:48624357-48624379 GCCATGAGTTGGGGGGTGGGGGG + Intergenic
954920105 3:54183328-54183350 GTAAGCAGCTGTGGGGTTTGTGG + Intronic
955910636 3:63856243-63856265 GGGAAGAGCTGTGGGGTGTGTGG + Intronic
956962914 3:74423492-74423514 GCCACGGGGTGTGGGGTTAGTGG - Intronic
957051865 3:75417751-75417773 GCCATGTGCTCTGGGGGCTGTGG + Intergenic
957084413 3:75667260-75667282 GACAAGAGCTGTGGGCTGTGGGG - Intergenic
958765388 3:98361143-98361165 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
959474291 3:106790540-106790562 GCCATGAACTGTGCAGTCTGGGG - Intergenic
959663525 3:108896148-108896170 GCCAGGGGCTGTGGGGTCCGGGG + Intergenic
959762111 3:109977830-109977852 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
959944841 3:112115416-112115438 CTCATGAGCTGTGGGCTTGGGGG + Intronic
960255084 3:115503200-115503222 GACATGAGCTGTGTGTTTGGGGG - Intergenic
960371106 3:116841125-116841147 GTGATGAGGTGTGAGGTTTGGGG + Intronic
960636514 3:119790089-119790111 GCCAGGGGCTGTGGGGTGAGGGG - Intronic
960785057 3:121363178-121363200 GCCATGAGCTGTGCAGCCTGGGG + Intronic
961885473 3:130093983-130094005 GCCATGTGCTCTGGGGGCTGTGG + Intronic
962443967 3:135448765-135448787 GGCCCCAGCTGTGGGGTTTGTGG - Intergenic
962829386 3:139126638-139126660 ACCATTATCTTTGGGGTTTGGGG - Intronic
963334098 3:143952597-143952619 TCTATGAGGTATGGGGTTTGTGG - Intergenic
963515238 3:146300876-146300898 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
965350846 3:167609748-167609770 GCCGTGAGCTGTGCAGTCTGGGG - Intronic
966771746 3:183510380-183510402 GGCAGGAGCTGTGGGGAGTGGGG + Intronic
967278835 3:187802928-187802950 GCCATGTGCTATGGGGCATGCGG - Intergenic
968227129 3:196979823-196979845 GCCCGGAGCTGTAGGGCTTGGGG - Intergenic
968489128 4:880816-880838 GGAAGGAGCTGTGGGATTTGGGG + Intronic
969135705 4:5027044-5027066 GCCAGGAGGTGTTGGGGTTGGGG + Intergenic
969247494 4:5945111-5945133 GCCTTGGGCTGAGGGTTTTGCGG + Intronic
969632452 4:8346566-8346588 GCAATGAGCTGGGGTGTATGTGG + Intergenic
971977010 4:33703350-33703372 CCCATGAGATGTGGGGATTATGG - Intergenic
972808695 4:42559100-42559122 CCCTTGAGCTCTGGAGTTTGGGG + Intronic
973053859 4:45630048-45630070 GCCATGAGCTGTGTTGCCTGGGG - Intergenic
974265098 4:59577070-59577092 CCCATGACATGTGGGGATTGTGG - Intergenic
974587435 4:63897153-63897175 GCCATGAGTTGGTGGGTTGGGGG - Intergenic
975299410 4:72772217-72772239 GCCAGGAGCAGTGAGGATTGTGG + Intergenic
975426259 4:74231388-74231410 TGCATGAGCTGTGGGGATGGTGG - Intronic
975502324 4:75100400-75100422 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
976259762 4:83134737-83134759 CCCATGACATGTGGGGATTGTGG + Intronic
976820574 4:89201905-89201927 CCCATGACCTGTGGGGATTTTGG + Intergenic
977035097 4:91940880-91940902 GCCATGAGCTCTCGGGTCTTTGG - Intergenic
977474520 4:97488982-97489004 CCCATGAACTGTGGGAATTGTGG - Intronic
977854746 4:101875959-101875981 GCCATGAGCTTTTGAGTCTGGGG - Intronic
978116417 4:105024862-105024884 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
978281581 4:107022516-107022538 CTCATGAGCTGTGTGGCTTGAGG + Intronic
978302985 4:107292222-107292244 GCCTTGAGCAATGGGGTCTGAGG + Intergenic
979399379 4:120229561-120229583 TCTATTAGCTGTGGGGCTTGGGG - Intergenic
979740085 4:124138862-124138884 TCCATGAGATGTGGGAATTGTGG - Intergenic
980412922 4:132446868-132446890 GCCATGAGCTATGGAGCCTGGGG - Intronic
981051042 4:140309813-140309835 GCCATGAGCTGTGGGGTTTGGGG - Intronic
982319167 4:154060991-154061013 GCCTTGAGCAATGGGGTCTGAGG - Intergenic
983151061 4:164282141-164282163 GCCATGAGATGTGTGATGTGAGG - Intronic
983760259 4:171396381-171396403 CCCATGACATGTGGGGATTGTGG - Intergenic
985224056 4:187740080-187740102 GCTATGTGCTGTGTGTTTTGTGG - Intergenic
985446577 4:190024289-190024311 GACAAGAGCTGTGGGCTGTGGGG + Intergenic
985692818 5:1323123-1323145 GCCCTGAGCTGAGGGGTTCCTGG - Intronic
985692855 5:1323238-1323260 GCCCTGAGCTGAGGGGTTCCTGG - Intronic
986042839 5:4010587-4010609 GCCCTGTGCTGTGGGGTTCAAGG - Intergenic
986265571 5:6187306-6187328 CCCTTAACCTGTGGGGTTTGTGG + Intergenic
986271766 5:6237321-6237343 CTCAGCAGCTGTGGGGTTTGGGG + Intergenic
987069094 5:14318927-14318949 GCCATGAGAAATGGGGTGTGGGG - Intronic
987206249 5:15629189-15629211 GACATGAGCTCAGGAGTTTGAGG + Intronic
987516629 5:18918434-18918456 GCAAGAAGCTGTGGGGTGTGTGG + Intergenic
988034793 5:25813296-25813318 GCCAGGGGCTGTGGGGGTGGAGG - Intergenic
988440501 5:31227601-31227623 GCCTTGATCTGTGAGGTTTTAGG - Intronic
989215396 5:38899851-38899873 GCCATGAGCTGTGCTGCCTGGGG + Intronic
989577616 5:43003033-43003055 TCCATGAGCTGAGGTGGTTGAGG + Intergenic
989614844 5:43329312-43329334 GCCTTGAGCAATGGGGTCTGAGG + Intergenic
990178281 5:53131450-53131472 CCCATGACATGTGGGGATTGTGG + Intergenic
990237129 5:53780481-53780503 GAGATAAGCTGTGGGGGTTGTGG - Intergenic
991449394 5:66736003-66736025 GCAAATAGCTGTGGGATTTGGGG + Intronic
991980506 5:72225507-72225529 GGCATGAGCTTTGGGGCTGGTGG + Intronic
992162379 5:74015945-74015967 GCCAACAGCTGTGGGGCCTGGGG - Intergenic
992177266 5:74162436-74162458 GACATGAGCTGCTGGATTTGCGG + Intergenic
992300393 5:75372341-75372363 ACAATCAGCTGTGGGGTATGGGG - Exonic
992531859 5:77659755-77659777 GCCATGAGCTGTACTGCTTGGGG + Intergenic
992966471 5:82006751-82006773 GCCAGGGGCTGTGGGGATTCTGG - Intronic
993239460 5:85362182-85362204 GCCAAGAGCTGGGGGGAGTGGGG - Intergenic
993322820 5:86495263-86495285 GTCTTGAGCTGAGGAGTTTGAGG - Intergenic
993874884 5:93294514-93294536 GCCTTGACCTGTTGGGTTGGAGG - Intergenic
994381790 5:99079890-99079912 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
995778035 5:115746330-115746352 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
995879610 5:116829740-116829762 CACAGGAGCTGTGGGGTTTGTGG + Intergenic
996692232 5:126352512-126352534 CCCTTGATCTGTGGGGTCTGGGG - Intergenic
996908177 5:128625677-128625699 GGCTTGAGCTGTGGAGGTTGAGG + Intronic
997186168 5:131884248-131884270 GCCATGAGCTGTGCAGCCTGGGG - Intronic
999209531 5:149875705-149875727 GGCTTGAGCTCAGGGGTTTGAGG - Intronic
1000398216 5:160798097-160798119 GCCAAGAGCTGAGGAGGTTGGGG + Intronic
1000929429 5:167233126-167233148 ACTATGAGCTCTGGGGTTGGAGG + Intergenic
1002343614 5:178532964-178532986 GCCCTGAGCTGTGGGGTCCCTGG + Intronic
1003634659 6:7821227-7821249 CCCAAGAACTGTGGGGATTGGGG + Intronic
1005271964 6:24175531-24175553 GTCATGGCCTGTGTGGTTTGGGG - Intronic
1005421599 6:25656732-25656754 GTCATGAGCTTTGGGGTTAGGGG + Intronic
1006463040 6:34174974-34174996 GCCATGAGCTGTGCAGCATGGGG + Intergenic
1007216938 6:40247748-40247770 GCCAAGGGCAGTGGGGTCTGAGG - Intergenic
1008312106 6:49989419-49989441 GCCATGAGCTGTGTAGCCTGAGG - Intergenic
1008337736 6:50326528-50326550 CCCATGAGATGTGGGGATTATGG + Intergenic
1010483636 6:76383022-76383044 GCCATGAGCTGTGCGGGCTGGGG + Intergenic
1011322880 6:86116368-86116390 TCCATGAGCTGTGCAGTCTGTGG + Intergenic
1013041161 6:106435247-106435269 GGCTTGAGCTGAGGAGTTTGAGG - Intergenic
1013560305 6:111296912-111296934 GCCATCAGCTGTGGAGGTTGGGG - Intergenic
1017270154 6:152494817-152494839 GCCTTGAGCAATGGGGTCTGAGG - Intronic
1018221584 6:161586089-161586111 CCCAGGAGCTGAGGAGTTTGAGG - Intronic
1019666859 7:2256299-2256321 GCCATGGTCTGTGGTGTGTGTGG - Intronic
1019743980 7:2689275-2689297 GCCCGGAGCTGTGCGGTTTAGGG + Intronic
1020035095 7:4959495-4959517 GCCAGGAGGTGGGGGGTTGGTGG + Intergenic
1020462149 7:8437989-8438011 GCCATCAGCTGTAGTTTTTGTGG - Intronic
1021926724 7:25541014-25541036 ACCATGAGCTGTGTAGTTTAAGG - Intergenic
1022909673 7:34888473-34888495 GAGATGAGGTTTGGGGTTTGGGG + Intergenic
1023367070 7:39475003-39475025 GCCAGGAGCTGTGGGGGCCGGGG - Intronic
1024204962 7:47150077-47150099 GCCATTACCTGTGTGGTTTTAGG - Intergenic
1024256881 7:47546021-47546043 GCCATGAGATCTGGGGATAGAGG + Intronic
1027318441 7:76998246-76998268 GGGATGAGGTGTGGGGTGTGTGG + Intergenic
1029317529 7:99727982-99728004 GCCTTGAGCAATGGGGTCTGAGG - Intronic
1029797387 7:102909831-102909853 TCGATGAGCTGTGAGGCTTGGGG + Intronic
1030527519 7:110672348-110672370 CCCATGACATGTGGGGATTGTGG + Intronic
1030917905 7:115339705-115339727 CCCATAAGCTGTAGGTTTTGAGG - Intergenic
1031276227 7:119727160-119727182 GGCATCAGCTGTGGGGAATGAGG - Intergenic
1031818401 7:126469480-126469502 CCCATGAGATGTGGGGATTGTGG - Intronic
1032254970 7:130289864-130289886 GCCATGACTTGTTGTGTTTGAGG - Intergenic
1032696938 7:134345211-134345233 TGCATGAGGTGTGGGATTTGCGG + Intergenic
1034143851 7:148850760-148850782 GGCATCCGCTGTGGGGTTGGCGG - Intronic
1034163242 7:149007423-149007445 ACCAGGAGCTGTGGGGTCTGGGG + Intronic
1034753462 7:153592347-153592369 ACCATGAGCTGTGATGTCTGGGG + Intergenic
1035228550 7:157446862-157446884 CCCATGAGTTGTGGGTTCTGGGG + Intergenic
1035275765 7:157747045-157747067 TCCCTGAGCTGTGGGGTGTCCGG + Intronic
1035275787 7:157747168-157747190 TCCCTGAGCTGTGGGGTGTGCGG + Intronic
1035275819 7:157747332-157747354 TCCCTGAGCTGTGGGGTGTCCGG + Intronic
1035275853 7:157747496-157747518 TCCCTGAGCTGTGGGGTGTGCGG + Intronic
1035275877 7:157747619-157747641 TCTCTGAGCTGTGGGGTGTGCGG + Intronic
1035275919 7:157747865-157747887 TCCCTGAGCTGTGGGGTGTCCGG + Intronic
1035275997 7:157748275-157748297 TCCCTGAGCTGTGGGGTGTCTGG + Intronic
1035276031 7:157748439-157748461 TCCCTGAGCTGTGGGGTGTCTGG + Intronic
1035276203 7:157749382-157749404 TCCCTGAGCTGTGGGGTGTCCGG + Intronic
1035276273 7:157749751-157749773 TCCCTGAGCTGCGGGGTGTGTGG + Intronic
1035595995 8:858410-858432 GCCATGGGCTGTGGGGAGGGAGG + Intergenic
1035672235 8:1427566-1427588 TCCATGACATGTGGGGATTGTGG - Intergenic
1035835461 8:2746669-2746691 GATGTTAGCTGTGGGGTTTGTGG - Intergenic
1036524016 8:9518542-9518564 GCAATAAGCTGTTGGGTTTCTGG - Intergenic
1037566056 8:20119385-20119407 GCCAGGTGCTATGGGGGTTGGGG + Intergenic
1037765992 8:21772622-21772644 GCCATGAGGGCTGGGCTTTGGGG - Intronic
1037882582 8:22580185-22580207 ACCGTGTGCTGTGGGTTTTGGGG + Intronic
1038425138 8:27459970-27459992 GCCATGAGCAGGGGGGTTGTGGG + Exonic
1038581806 8:28754285-28754307 GCACTGAGCTGTGGGCTTCGGGG + Intronic
1042867597 8:73369311-73369333 ACGCTGAGCTGTGGGGTTGGAGG + Intergenic
1043806063 8:84672809-84672831 CCCATGACATGTGGGGATTGTGG + Intronic
1043959097 8:86394956-86394978 GCCAGGAGATGAGGGGGTTGGGG + Intronic
1044298543 8:90556358-90556380 GCTATGAGCTGTGCAGCTTGGGG - Intergenic
1045506057 8:102779572-102779594 GCCAGGTGCTGTGTGGGTTGAGG - Intergenic
1047958846 8:129996272-129996294 GCCGTGGCCTGTGGGGTGTGAGG - Intronic
1048016573 8:130502268-130502290 CCCATGAGATGTGGGAATTGTGG - Intergenic
1048383248 8:133887221-133887243 CCCATAAGCTGTGGGGTTAGGGG - Intergenic
1049003079 8:139838433-139838455 GCCATGACCTCTGGGGCATGTGG + Intronic
1050309420 9:4337918-4337940 CACATAAGCTGTGTGGTTTGGGG - Intronic
1050985037 9:12071674-12071696 CCCATGACATGTGGGGATTGTGG - Intergenic
1051092568 9:13426879-13426901 GCCAAGAGTTGTGGGGGTGGTGG + Intergenic
1051267661 9:15324142-15324164 CCCATGAGATGTGGGGATTATGG - Intergenic
1052848096 9:33355091-33355113 AACATGAGCTGTGTGGTTTTGGG + Intronic
1052881575 9:33603920-33603942 ACCCTGAGCTGTGGGGTTAGGGG - Intergenic
1052967711 9:34353421-34353443 GCCAGGAACTGGAGGGTTTGAGG - Intergenic
1053147689 9:35722977-35722999 GCCATGAACTGTGGGCCTGGGGG + Intronic
1053358123 9:37464632-37464654 GCGAGGAGCTGTGGGGGATGCGG - Intronic
1053494741 9:38541916-38541938 ACCCTGAGCTGTGGGGTTAGGGG + Intronic
1054816849 9:69483820-69483842 GCCAGGGGCTGTGGGGTCTGGGG - Intronic
1055692377 9:78846368-78846390 ACCATGAGCTGTGCAGTCTGAGG + Intergenic
1060209636 9:121701760-121701782 GCCATGAGCTGGGGGGCGGGCGG - Intronic
1061199660 9:129129974-129129996 GACTTGAGCTCTGGAGTTTGAGG + Intronic
1061388863 9:130306214-130306236 TCCAGGAGATGTGGGGTGTGGGG - Intronic
1061483644 9:130909278-130909300 TCCACAAGCTGTGGGGGTTGGGG - Intronic
1061995829 9:134182437-134182459 CCCATGTGCTGTGTGGTGTGTGG + Intergenic
1062026420 9:134342715-134342737 GCCCTGACCTGGTGGGTTTGGGG + Intronic
1062076433 9:134592475-134592497 TTCATGCGTTGTGGGGTTTGGGG + Intergenic
1062257129 9:135631954-135631976 GGCTTGAGCTCAGGGGTTTGAGG - Intronic
1203530818 Un_GL000213v1:140310-140332 GCCAACAGCTGTGGGGCTTCTGG + Intergenic
1185986419 X:4839476-4839498 CCCATGACATGTGGGGATTGTGG + Intergenic
1186138035 X:6540451-6540473 CCCATGACCTGTGGGGATTATGG - Intergenic
1186198513 X:7133089-7133111 GCCATCTGCTGTGGGGCTTTCGG + Intronic
1186582301 X:10833440-10833462 GGAAGGAGCTGTGGGGTTAGAGG + Intronic
1187322343 X:18251063-18251085 CCCATGACCTGTGGGGATTATGG + Intronic
1187421008 X:19133668-19133690 TCCAAGAGCTGTTGGGTTTGGGG - Intergenic
1187639483 X:21273024-21273046 CCCATGAGCTGTGCAGATTGGGG - Intergenic
1188541904 X:31260156-31260178 GCCATGAGCCCAGGGGTTCGAGG + Intronic
1188619113 X:32197455-32197477 TTCATGAGCTTTGGGATTTGGGG + Intronic
1189661574 X:43305950-43305972 GCCTTGAGCCCAGGGGTTTGAGG - Intergenic
1189858515 X:45248185-45248207 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
1190150670 X:47944773-47944795 TCCATGACCTGTGGGGATTATGG - Intronic
1190898984 X:54650695-54650717 GCCAGGAGCTGTGGAGTCTAGGG - Intergenic
1191200665 X:57777965-57777987 GTCATGGGCTGGGGGGCTTGGGG - Intergenic
1191656550 X:63604930-63604952 TCCATGTGCTGTGGGGCCTGTGG + Intergenic
1192077810 X:68018099-68018121 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
1192088095 X:68121727-68121749 GCCTTGAGCTGTGCTGTGTGGGG - Intronic
1192454980 X:71268976-71268998 GCCTTGAGCAATGGGGTCTGAGG - Intergenic
1192913799 X:75633522-75633544 GCCTTGAGCAGTGGGGTCTGAGG + Intergenic
1193088341 X:77467749-77467771 GCCATGAGCTGTGCAGCCTGTGG - Intergenic
1193459075 X:81768646-81768668 GGCATGAGCTGAGGGCTTAGTGG - Intergenic
1193993906 X:88342114-88342136 GCCATGGGAGCTGGGGTTTGTGG + Intergenic
1194307039 X:92260033-92260055 GCCATGAGCTGTGCAGCCTGGGG + Intronic
1194591475 X:95805074-95805096 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
1194626267 X:96229876-96229898 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
1196247325 X:113415308-113415330 GCCATGAGCTGTGAAGCCTGGGG - Intergenic
1196466128 X:115973158-115973180 GCCATGAGCTGTGCAGCCTGGGG - Intergenic
1196467760 X:115990785-115990807 GCTATGAGCTGTGTGGCCTGGGG - Intergenic
1196590762 X:117483575-117483597 GCCATGAGCTGTGGAGCCTGGGG - Intergenic
1197476650 X:126933438-126933460 GCCATGAGCTGTGCAGCCTGGGG + Intergenic
1197508935 X:127346672-127346694 GTCATGAGCTGTGCAGCTTGGGG + Intergenic
1197560414 X:128014231-128014253 TCCATGATATGTGGGGATTGTGG + Intergenic
1197717484 X:129719942-129719964 GCTAGGAGCCGTGGGGTATGTGG - Intergenic
1198421280 X:136472622-136472644 GCCCTGGGCTGTGGTGGTTGAGG - Intergenic
1198862835 X:141089105-141089127 ACCATGAGCTGTGCAGCTTGGGG - Intergenic
1198899858 X:141498284-141498306 ACCATGAGCTGTGCAGCTTGGGG + Intergenic
1198996731 X:142580907-142580929 GCCAGGAGGTGTGCAGTTTGGGG + Intergenic
1199162309 X:144627951-144627973 GCCATGAGCTGTGCAGTATGGGG - Intergenic
1199246018 X:145604826-145604848 GCCATGAGCTGTGCAGCCTGGGG - Intergenic