ID: 981051252

View in Genome Browser
Species Human (GRCh38)
Location 4:140311597-140311619
Sequence CAGGCTTACCAGGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 311}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981051252_981051267 28 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051267 4:140311648-140311670 TGGGGAACAGGGGTGCCTTGGGG No data
981051252_981051259 8 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051259 4:140311628-140311650 TTGATATCAGCACAGTGGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 134
981051252_981051263 17 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051263 4:140311637-140311659 GCACAGTGGTGTGGGGAACAGGG 0: 1
1: 0
2: 5
3: 33
4: 305
981051252_981051266 27 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051266 4:140311647-140311669 GTGGGGAACAGGGGTGCCTTGGG 0: 1
1: 0
2: 1
3: 19
4: 245
981051252_981051258 3 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051258 4:140311623-140311645 GTGTGTTGATATCAGCACAGTGG 0: 1
1: 0
2: 0
3: 9
4: 129
981051252_981051264 18 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051264 4:140311638-140311660 CACAGTGGTGTGGGGAACAGGGG 0: 1
1: 0
2: 5
3: 42
4: 384
981051252_981051265 26 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051265 4:140311646-140311668 TGTGGGGAACAGGGGTGCCTTGG 0: 1
1: 0
2: 1
3: 32
4: 290
981051252_981051260 9 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051260 4:140311629-140311651 TGATATCAGCACAGTGGTGTGGG 0: 1
1: 0
2: 2
3: 16
4: 149
981051252_981051262 16 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051262 4:140311636-140311658 AGCACAGTGGTGTGGGGAACAGG 0: 1
1: 0
2: 3
3: 28
4: 330
981051252_981051261 10 Left 981051252 4:140311597-140311619 CCCTCTTCCTCCTGGTAAGCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 981051261 4:140311630-140311652 GATATCAGCACAGTGGTGTGGGG 0: 1
1: 0
2: 1
3: 18
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981051252 Original CRISPR CAGGCTTACCAGGAGGAAGA GGG (reversed) Intronic
900297195 1:1957729-1957751 CAGGCTGAGCAGGAGGGAGCCGG + Intronic
901232703 1:7650073-7650095 CAGTCTTACCAGGAGCAAGATGG + Intronic
901600445 1:10419526-10419548 CAGGCTTACCTGGATGAGGCTGG - Exonic
902602174 1:17547384-17547406 CAGGCTCTCAAGGAGAAAGAGGG - Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903309737 1:22445286-22445308 CTGGCTTTCCATGTGGAAGAGGG + Intergenic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
905317294 1:37091297-37091319 CACACTTATCAGGAGGAAGGTGG + Intergenic
908798894 1:67858627-67858649 AAGGCTCACTAAGAGGAAGAAGG - Intergenic
909801756 1:79818821-79818843 CTGGCTGACCAGGAAAAAGAGGG + Intergenic
911361492 1:96882663-96882685 CAGGCTCACCACTAGTAAGATGG - Intergenic
912559426 1:110539299-110539321 CAGGCTGACCAATAGGAGGAAGG + Intergenic
915969358 1:160343006-160343028 CAGACGGACCCGGAGGAAGACGG - Intronic
916852130 1:168714212-168714234 CAGACTCACCAGCAGGAATATGG + Exonic
917649707 1:177064453-177064475 AAGGCTTTTCATGAGGAAGAAGG + Intronic
919616036 1:199810288-199810310 CAGGATTACAAAGACGAAGAAGG + Intergenic
920186383 1:204161849-204161871 CAGGCTTTCCAGCTGGAAAATGG + Intronic
920387619 1:205579936-205579958 CGGGCTTACCTGGAGGAAGACGG - Exonic
920838753 1:209536145-209536167 CAGAATTGCCAGGAGGCAGAGGG + Intergenic
920892593 1:210005177-210005199 CAGGCTTAGTAGGGGAAAGATGG + Intronic
921325469 1:213983329-213983351 CAGGCACACCAGGAGGGACAGGG + Intronic
922120775 1:222665351-222665373 CAGGCGTTCCACCAGGAAGACGG + Exonic
922224880 1:223637472-223637494 CAGGCTGACCAGGTGGCACATGG + Intronic
922291509 1:224212688-224212710 CAGGCTGACCAGCAGAAACATGG + Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923324210 1:232866489-232866511 AAGGCTGACCAGGATGGAGAGGG - Intergenic
923357375 1:233172699-233172721 CAGGAGTACCTGGAGGAAGCAGG - Intronic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1064249287 10:13694464-13694486 CAGGCAGATAAGGAGGAAGAGGG - Intronic
1064256116 10:13743975-13743997 CAGGGTTACATGGAGGAAAAAGG + Intronic
1067147040 10:43701514-43701536 CAGGCTGCCCAGGAAGAACAAGG - Intergenic
1067223670 10:44361819-44361841 CAGGCTTTCCTGGAGGAGAAGGG + Intergenic
1067303662 10:45037701-45037723 GGGGCTTACCAGAGGGAAGAGGG + Intergenic
1069551510 10:69367491-69367513 GAGGCTTTGGAGGAGGAAGAGGG + Intronic
1069815053 10:71188451-71188473 GAGGCCTTCCAGGAGGCAGAGGG - Intergenic
1069925998 10:71851192-71851214 GAGGCTGGCCAGGAGGAAGAGGG + Exonic
1070145557 10:73771309-73771331 CAGGATTAGCAGGAAAAAGAGGG - Exonic
1070965274 10:80526622-80526644 CAGGCTTACAGGGGGGAAGGCGG - Exonic
1072260099 10:93661527-93661549 CAGGCTTGCCAAGAGGAATAAGG - Intronic
1074013607 10:109509403-109509425 AAAGCTAATCAGGAGGAAGAGGG - Intergenic
1074576761 10:114677061-114677083 CAGGCTTTTCAGAAGTAAGAGGG - Intronic
1075553212 10:123409386-123409408 CAGGCTTCCGAGGAGGTGGAGGG + Intergenic
1075847208 10:125554654-125554676 CAAGATTGACAGGAGGAAGATGG - Intergenic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1078023204 11:7672325-7672347 CAGGCTCAGGAGGAGCAAGAGGG + Intronic
1078368545 11:10726323-10726345 AAGGCTCACCAGGAGGAGGTAGG - Intergenic
1078682965 11:13497511-13497533 TAGGGTTACCATAAGGAAGAAGG + Intergenic
1079370974 11:19851974-19851996 CAGGCTTTGAAGGTGGAAGAAGG + Intronic
1079491940 11:20998699-20998721 AATGCTGACCAGCAGGAAGATGG - Intronic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1083690425 11:64404943-64404965 CTGGCTGAACTGGAGGAAGAGGG - Intergenic
1083696362 11:64445399-64445421 AAGGTTTGCCAGCAGGAAGAAGG + Intergenic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1087140776 11:94763759-94763781 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1089065756 11:115660620-115660642 CAGGCGCGCCAGGAGGAAGCCGG - Intergenic
1090480827 11:127066777-127066799 GAGGCAGAGCAGGAGGAAGATGG + Intergenic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091353538 11:134916293-134916315 CAGGCTCACAGGGAGGCAGAAGG - Intergenic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1097533892 12:60840492-60840514 CAGGCTGAGGAGGAGTAAGAAGG - Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1101799582 12:108009085-108009107 CAGGCTCACCGAGAGGCAGAGGG - Intergenic
1103759978 12:123241920-123241942 CAAGCTCTCCAGGAGGATGAGGG + Intronic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104906189 12:132214663-132214685 CAGGCTGGACAGGAGGCAGAGGG - Intronic
1106157032 13:27169026-27169048 CCGGCATACCAGGAGGAGGCAGG + Intronic
1109772784 13:66998648-66998670 CTGGCTAACTATGAGGAAGAGGG - Intronic
1110427726 13:75388071-75388093 CCGGCTTTGCAGGTGGAAGAAGG - Intronic
1111102772 13:83609565-83609587 CAGGATTAGCAGGAGTATGAGGG + Intergenic
1112300754 13:98227691-98227713 CACGCTAGCCAGGAGGTAGAAGG + Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113834790 13:113321691-113321713 CAGGCTTTCAAGGTGGAAGGTGG + Exonic
1113903316 13:113807957-113807979 CAGGCCTCCCCAGAGGAAGAGGG - Intronic
1115069642 14:29305182-29305204 CTGGCTTACAAGGAGGGAGATGG + Intergenic
1115389019 14:32832783-32832805 CAGGGTTGCCATGAGAAAGAGGG - Exonic
1117487926 14:56217285-56217307 CAGGCCTGCCAGGAGGTGGAGGG - Intronic
1117745604 14:58866387-58866409 CAGGTTTCCCAGCAGGGAGAAGG - Intergenic
1118186422 14:63542718-63542740 CAGGAGGACCGGGAGGAAGAAGG + Intronic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118346814 14:64946996-64947018 CAAGCCTATCAGGAGGTAGAGGG + Exonic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119372076 14:74155136-74155158 CAAGCTTTCCAGGAAGAAGAGGG - Intronic
1119549544 14:75498321-75498343 AAAGCTTACCAGAAAGAAGAGGG + Intergenic
1119869934 14:78008392-78008414 CTGGCACACCAGGAGGGAGAAGG - Intergenic
1120484852 14:85100230-85100252 GAGGCTAAGGAGGAGGAAGAGGG + Intergenic
1121782008 14:96627991-96628013 CAGGCCTAGCAGGAAGAAGTGGG + Intergenic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122624956 14:103079862-103079884 CAAGTTCTCCAGGAGGAAGATGG - Intergenic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1125245134 15:37627765-37627787 CTGAGTTACCAGGAAGAAGATGG + Intergenic
1125430913 15:39592679-39592701 CAGGCTGACCATGACAAAGATGG + Exonic
1125908448 15:43415065-43415087 CAGAATTTCCAGGAAGAAGATGG + Intronic
1126199887 15:45973827-45973849 GAGGCCTAGCAGGAGAAAGATGG + Intergenic
1126297493 15:47156963-47156985 GAGCCTTATCTGGAGGAAGAAGG + Intergenic
1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG + Exonic
1127483167 15:59395840-59395862 CAGGCTGACTAGGAGAAAGGGGG - Intronic
1129885482 15:79034103-79034125 GAGGCTTCCCAGGGGGAAGTAGG - Intronic
1131387911 15:92022822-92022844 GAGGCTTCCCAGGAAGAAGAAGG + Intronic
1132207141 15:99993927-99993949 CAGGATTCCCAGCAGCAAGAAGG + Intronic
1132815203 16:1822533-1822555 CAGGCTGAGCAGGAAGGAGAAGG - Intronic
1133483356 16:6193828-6193850 CAAGTTTACCAGGAGAATGAAGG - Intronic
1133608762 16:7413528-7413550 CAGCCTTACAAGGAGACAGAGGG - Intronic
1134186310 16:12087825-12087847 CACGTCAACCAGGAGGAAGAGGG - Exonic
1136548368 16:30967913-30967935 CAGGCAAACTAGGAGGAAGGTGG - Intronic
1137005342 16:35270562-35270584 GAGACTTACCAGGAGAAAGGTGG - Intergenic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1139910361 16:70393878-70393900 CAGGTTTCCCAGGAGGCAGAAGG - Intronic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141875514 16:86821451-86821473 CAAGCTGACCAGGAGGAGAATGG + Intergenic
1142889145 17:2931757-2931779 CAGGCTGACCTGCAAGAAGAGGG - Intronic
1143373100 17:6452449-6452471 CAGGCATACCAGAAGCTAGAAGG + Exonic
1143940332 17:10534237-10534259 CAGGGTTTCCTGGAGGCAGAGGG - Intronic
1143954638 17:10658752-10658774 CAGTCTCACCTGGAGGGAGAGGG - Intergenic
1144800054 17:17919973-17919995 CAGGCTTACCAGGAAGACCTGGG - Intronic
1146002679 17:29140524-29140546 CAGGTATGCCAGGAGGGAGAGGG + Intronic
1146423518 17:32712979-32713001 CATGGATACCAGGAGGTAGAGGG + Intronic
1147130371 17:38404408-38404430 CTGGCTTCCCGGGAGGTAGATGG - Exonic
1147182599 17:38696023-38696045 GAGGCATTCCAGGTGGAAGAGGG + Intergenic
1147590528 17:41680282-41680304 CAGGCAGCCCAGCAGGAAGAGGG + Intergenic
1147669319 17:42167672-42167694 GAGGCATAACAGGGGGAAGATGG - Intronic
1149538475 17:57450911-57450933 GAGACTTAGCTGGAGGAAGAGGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150455147 17:65301274-65301296 CTGGCTTCCCTGGAGGAAGCAGG + Intergenic
1154228965 18:12536411-12536433 CATGGTTACCAAGAGGGAGAAGG + Intronic
1155138123 18:23017041-23017063 CAGGCGTAACAGCAGGAATAAGG + Intronic
1157190915 18:45580945-45580967 CAGGCTGAGCAGGAGGCAGGAGG + Intronic
1159785049 18:72703952-72703974 CATGCTTAGCAGAAGGAAAACGG - Intergenic
1160099524 18:75906990-75907012 CAGGCTGAGCTGGAGGAAGAAGG + Intergenic
1162353601 19:10166608-10166630 CAGGCTGACGAGGACGAAGATGG - Exonic
1162554913 19:11380922-11380944 CAGGATGACCACGAGGATGAGGG + Exonic
1162717209 19:12641641-12641663 CAGGCATACAGGGAGGATGAAGG - Intergenic
1168131193 19:54320411-54320433 CATGCTCACCAGGATGAGGATGG + Intergenic
1168179173 19:54648624-54648646 CATGCTCACCAGGACGAGGATGG - Intronic
1168231769 19:55037115-55037137 AAGGCTAAGCAGGAAGAAGATGG - Intronic
1168332374 19:55578144-55578166 AAGGCCGAGCAGGAGGAAGAAGG - Exonic
1168405307 19:56107570-56107592 AAGGGTCACCAGGAGAAAGAGGG + Intronic
925615641 2:5742295-5742317 CAGGCTTCCCTGGAGCAAGAAGG - Intergenic
926145249 2:10393373-10393395 CAGGCTTCCTAGCAGGAAGGGGG - Intronic
926971733 2:18473556-18473578 CAGGCCTTCCAGGGGTAAGAGGG - Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
931430112 2:62202598-62202620 CAGGCTTGCATTGAGGAAGATGG + Intronic
932370869 2:71186556-71186578 CAGGCTCACGAGGATGAAGGAGG + Exonic
932814696 2:74852458-74852480 GAGGCTCCCCAGGAGGAAAAAGG - Intronic
933988358 2:87613054-87613076 CAGGCTCACCAGGAAGCAGGAGG - Intergenic
935086436 2:99850196-99850218 CAGGTTTATAAGTAGGAAGAGGG - Intronic
936305483 2:111337754-111337776 CAGGCTCACCAGGAAGCAGGAGG + Intergenic
936531331 2:113278627-113278649 CAGGCTTCCCGGGAGGATCAAGG + Intronic
937745452 2:125407399-125407421 TGGGCTTATGAGGAGGAAGATGG - Intergenic
938224624 2:129605165-129605187 CTGGCTTACCAGCAAGCAGATGG + Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
942250042 2:174039723-174039745 CAGGCTTCCCAAGAGGCACACGG + Intergenic
942299180 2:174545983-174546005 CTGGCTGAGCAGGTGGAAGAAGG + Intergenic
946059908 2:216933041-216933063 CAGGCTCAGCAGGAGGAATTTGG + Intergenic
948635360 2:239331119-239331141 CAGCCTGCCCAGGAGGAAGCGGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169460494 20:5790210-5790232 CAGGCTCCCTGGGAGGAAGAAGG - Intronic
1169639508 20:7734661-7734683 CAGGTTTTCCAAGAGAAAGATGG + Intergenic
1169959477 20:11143076-11143098 CAGGTTTGGCTGGAGGAAGATGG + Intergenic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1171062965 20:21984292-21984314 CAGGAATATCAGGAGGGAGATGG + Intergenic
1171451227 20:25237477-25237499 CAGTCTTCCCAGGAGGAGGCCGG - Intergenic
1171723841 20:28596158-28596180 CAGGCTTGACAGGAGCAAAAGGG + Intergenic
1171754220 20:29086888-29086910 CAGGCTTGTCAGGAGCAAAAGGG - Intergenic
1171859513 20:30383753-30383775 CAGGCTTGACAGGAGCAAAAGGG - Intronic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172463124 20:35135043-35135065 CAGGATACCCAGGAGAAAGAGGG - Intronic
1173317117 20:41955022-41955044 CAGGCTGAAGGGGAGGAAGAAGG - Intergenic
1173323607 20:42011958-42011980 CAAGCTGACCAGGAAGGAGAGGG - Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1176612534 21:8997080-8997102 CAAGTTTTCCAGCAGGAAGAAGG - Intergenic
1176712594 21:10166391-10166413 CAAGTTTTCCAGCAGGAAGAAGG + Intergenic
1177064950 21:16419140-16419162 CAGATTTACCATGAGGAATAGGG + Intergenic
1178563180 21:33658246-33658268 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1178933762 21:36842865-36842887 CAGCCTAACCAGCAGGATGAGGG + Intronic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1180199537 21:46216039-46216061 CAGGCCTGCCATGGGGAAGAAGG - Intronic
1180297397 22:10954849-10954871 CAGGCTTGACAGGAGCAAAAGGG + Intergenic
1180411035 22:12608947-12608969 CAGGCTTGACAGGAGCAAAAGGG - Intergenic
1180988006 22:19916982-19917004 CAGGCTTGCCAGTGGGGAGAAGG - Intronic
1181760746 22:25057243-25057265 CAGGATCCCCAGGTGGAAGAAGG + Intronic
1181780452 22:25189096-25189118 CTGGCCTCCCAGGAAGAAGAGGG - Intronic
1182814526 22:33148578-33148600 TAGGATTCCCAGGAGCAAGATGG + Intergenic
1183751545 22:39723767-39723789 CCAGCTGAGCAGGAGGAAGACGG + Intergenic
1184737788 22:46409435-46409457 CAGGCTTGACAGGAGGCAGACGG + Intronic
1185274341 22:49943885-49943907 CACGCTACCCAGAAGGAAGAAGG + Intergenic
950452312 3:13072327-13072349 CAGGCTTCCCAGGGGGCAGTGGG - Intronic
950755576 3:15168760-15168782 CAAGCTTACCAAGATGAAGGCGG + Intergenic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952749281 3:36812329-36812351 CAGGCTGATCATGAGGCAGAGGG + Intergenic
953562007 3:43999065-43999087 CGGCTTTTCCAGGAGGAAGATGG + Intergenic
953827138 3:46263467-46263489 CAGGCTTTTGAGGAGGAAAATGG - Intronic
953938256 3:47066070-47066092 CAGACTGACGAGGAAGAAGAGGG - Intronic
954720166 3:52554748-52554770 CAGGCACACCTGGCGGAAGATGG + Exonic
954801665 3:53190564-53190586 GAGGCATTCCAGGTGGAAGAGGG + Intronic
955910488 3:63854674-63854696 CAGTCTTTCCAGGAGCTAGATGG - Intronic
957949097 3:87101302-87101324 CATGCTTACCTGGAGGATGTTGG - Intergenic
958966149 3:100561033-100561055 TAGGCTGACCACCAGGAAGAAGG - Intronic
961319636 3:126063834-126063856 CAGGGTTAGCAGGAGGCACATGG + Intronic
961369436 3:126420378-126420400 CAGGCCGGCCAGGAGGCAGAGGG + Intronic
961516886 3:127443630-127443652 CAGGCACACCAGCAGGGAGAGGG + Intergenic
961576023 3:127837116-127837138 AAGGCTCAGCAGCAGGAAGAAGG + Intergenic
964872037 3:161323912-161323934 CAGGCTTACCAAAAGGCTGAAGG + Intergenic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
967972015 3:195006094-195006116 CATCTTTCCCAGGAGGAAGAGGG + Intergenic
968983938 4:3865347-3865369 CAGGCTGCCCTGGAGGGAGAGGG - Intergenic
969193886 4:5545505-5545527 CAGAGTTATCAGGAGGAAGCAGG + Intronic
969304132 4:6315784-6315806 CAGGCTTCCCAGCAGCAATAAGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
971823287 4:31587351-31587373 GAGGCTGACCAGAAGGAAAACGG + Intergenic
973334706 4:48944410-48944432 CAGGCTCACAAGGAGAAAGGGGG - Intergenic
973727481 4:53790582-53790604 CAGTCTTAATAGGAGTAAGATGG + Intronic
974201217 4:58643278-58643300 CTTGCTTGCCAAGAGGAAGAAGG - Intergenic
975206359 4:71648093-71648115 CAGCCTTACCTGGATGAACAAGG + Intergenic
975618748 4:76274687-76274709 TAGGTTTTCCAGGAGGAAGAAGG + Intronic
976105022 4:81607077-81607099 CGGGCTTGCCAGCAGAAAGAAGG + Intronic
976653062 4:87456566-87456588 CAGCCATACCAGTATGAAGAGGG - Intronic
977868165 4:102056162-102056184 CAGTCTCACCAGTAGGATGAGGG - Intronic
979295603 4:119030033-119030055 GAGGCGGACGAGGAGGAAGAAGG + Exonic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
981176237 4:141687206-141687228 CCTGCTTACAAGGATGAAGATGG - Intronic
982204658 4:152988757-152988779 CAGGCTTGTCAGGAGGCAGCTGG + Intergenic
983344841 4:166515065-166515087 CAGGCTGAGGAGGAAGAAGAGGG + Intergenic
984568621 4:181362671-181362693 CAGACTCACCAGCAGGAAAAAGG + Intergenic
984868762 4:184308999-184309021 GAGGCTGAAGAGGAGGAAGAGGG + Intergenic
984984409 4:185314015-185314037 TAGGCAGAGCAGGAGGAAGAGGG + Intronic
985437658 4:189947440-189947462 CAGGCTTGACAGGAGCAAAAGGG - Intronic
986618835 5:9648821-9648843 CAGGCTCATGAAGAGGAAGAAGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987690931 5:21265878-21265900 CAGCCTTATGAGAAGGAAGAAGG + Intergenic
988401024 5:30760509-30760531 TAGGCTGAGGAGGAGGAAGACGG - Intergenic
990982595 5:61615413-61615435 CTGCCTTACCAGGGGGCAGAGGG - Intergenic
995551252 5:113283890-113283912 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
996884829 5:128342474-128342496 GAGACTTACCAGCAGGAAAACGG + Intronic
1000927928 5:167216308-167216330 AAGGATCACCAGGAGGAAGAAGG + Intergenic
1002086096 5:176776533-176776555 CAGGCTGACCGGAAAGAAGATGG - Intergenic
1002375301 5:178784615-178784637 CATTCTTACCAGCAGGAAGGAGG - Intergenic
1003056079 6:2821651-2821673 CTGCCTTACCAGGACCAAGATGG - Intergenic
1003108199 6:3231354-3231376 CTGGCTTCCCAGGCGGAGGAGGG - Intronic
1004423603 6:15492741-15492763 CTGGGTTTCGAGGAGGAAGATGG + Intronic
1005015990 6:21375984-21376006 CAGGCTTTCCAGGAGCAGCATGG + Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005632074 6:27717629-27717651 CTGGCCTCCCAGGAAGAAGAGGG + Intergenic
1006515877 6:34545298-34545320 CAGGCTTTCCAGGAGGAGCCAGG + Intronic
1008370912 6:50729250-50729272 TAAACTTACCAGCAGGAAGACGG + Exonic
1008853991 6:56059223-56059245 CAGGCCTACCAGGAAGAAATGGG - Exonic
1010164249 6:72897121-72897143 CAGGCATAGAAGGAGAAAGAAGG + Intronic
1010758686 6:79697504-79697526 CTGGCATACCTGTAGGAAGAAGG + Intronic
1013181258 6:107718695-107718717 CAGGATTTCCAGCAGTAAGAGGG - Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1015091570 6:129364911-129364933 CAGGCAGAGCAGGAGGAAGTGGG + Intronic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1017483351 6:154880044-154880066 CATGCTGACCAGGAGGAAGCCGG - Intronic
1018467086 6:164057800-164057822 CAGGCATGCCAGGAGAAAGTCGG - Intergenic
1018867864 6:167759564-167759586 CAGCCTGACCAGGCGGGAGATGG + Intergenic
1020333813 7:7046022-7046044 CAGGCTGTCCAGGAGAGAGATGG - Intergenic
1021776360 7:24058907-24058929 CAGGCATAGCATGAGGAAGATGG + Intergenic
1021988138 7:26117126-26117148 TGGGCTTCCCAGGAGGAAAAGGG + Intergenic
1022358695 7:29639653-29639675 AAGGCTTGCCAGGAGAAAGGTGG - Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1023362763 7:39432708-39432730 CACTCTTCCCAGGTGGAAGAGGG + Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023775441 7:43601695-43601717 GAGGATGACCAAGAGGAAGAGGG - Intronic
1023967721 7:44971664-44971686 CAGGCTCACCAGGTGCAATATGG + Exonic
1024192931 7:47031085-47031107 CAGGGTCGCCAGGAGGCAGAGGG + Intergenic
1024691588 7:51808928-51808950 CAGGGTTCCCAGGAAGAAAAAGG - Intergenic
1025923785 7:65939683-65939705 AAGGCTTAGCAGGAGAAACAAGG + Intronic
1026631200 7:72039700-72039722 CAGGCTTAGAAGGAGGAGTAAGG + Intronic
1026735640 7:72946846-72946868 CAGGCTTGGCAGGAAGAAAACGG - Intronic
1026785982 7:73301777-73301799 CAGGCTTGGCAGGAAGAAAATGG - Intergenic
1027108081 7:75418165-75418187 CAGGCTTGGCAGGAAGAAAACGG + Exonic
1027125408 7:75553520-75553542 CTGGCCTCCCTGGAGGAAGAGGG - Exonic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027499523 7:78931338-78931360 CAGTTATTCCAGGAGGAAGAGGG - Intronic
1028455789 7:91036568-91036590 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
1030127098 7:106164579-106164601 CAGTCTTGCCTGGAGGCAGAGGG + Intergenic
1032721600 7:134554631-134554653 GAGGCTTGCCAGGAGGAAGGTGG + Intronic
1033039472 7:137905082-137905104 CAGGCCTACCAGGAGGGAGGGGG - Intronic
1033286794 7:140048283-140048305 CTGGCTGCCCAGGAGGAACATGG - Intronic
1034004405 7:147453216-147453238 GAAGTTTACCAGGAGGAAAAGGG - Intronic
1034081837 7:148286116-148286138 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1036767263 8:11556884-11556906 CGGGCTTAGCAGGAGGAGGAGGG + Intronic
1038090596 8:24248663-24248685 CAGACAGACCAGGAAGAAGATGG + Intergenic
1038907360 8:31920570-31920592 AAGGCTTCCCAGGAGCCAGATGG - Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043645442 8:82511596-82511618 TAGGCTTTCCAGGAGGAACAGGG + Intergenic
1043962954 8:86438244-86438266 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1044229288 8:89757036-89757058 CAGTCTTACCTGGAGTTAGATGG + Intergenic
1044602967 8:94024311-94024333 CAAGGTTACCAGGATGAAGAAGG + Intergenic
1044865596 8:96568160-96568182 CAGGCTTTGCTGGAGAAAGAGGG - Intronic
1047021212 8:120776698-120776720 CAGGCTTATGAGGGGGAAGCAGG - Intronic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049352827 8:142173161-142173183 CAGGCTCACGAGGAGAAGGATGG + Intergenic
1049553505 8:143271341-143271363 CAGGCCTATCAGCATGAAGAGGG - Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1053649598 9:40152192-40152214 CAAGTTTTCCAGCAGGAAGAAGG + Intergenic
1053725761 9:40998878-40998900 CAGGCTTGACAGGAGCAAAAGGG - Intergenic
1053756153 9:41311755-41311777 CAAGTTTTCCAGCAGGAAGAAGG - Intergenic
1054330112 9:63743955-63743977 CAAGTTTTCCAGCAGGAAGAAGG + Intergenic
1054534983 9:66224012-66224034 CAAGTTTTCCAGCAGGAAGAAGG - Intergenic
1055972085 9:81921536-81921558 CAGGCTTACAGGGAAGAACATGG - Intergenic
1055973838 9:81936608-81936630 CAGGCTTACAGGGAAGAACATGG - Intergenic
1056200666 9:84272862-84272884 CAGGCTTGCCTGGAGGGATAGGG + Intergenic
1056310520 9:85336157-85336179 CAGGCTTATCAGAATGAAGAAGG + Intergenic
1056839308 9:89985795-89985817 CAGGCTTACCATGAGGGTTACGG - Intergenic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1062403534 9:136382861-136382883 CAGGCTCACGAGGAGGGAGGAGG + Intronic
1202797341 9_KI270719v1_random:135381-135403 CAAGTTTTCCAGCAGGAAGAAGG + Intergenic
1202804418 9_KI270720v1_random:37798-37820 CAGGCTTGACAGGAGAAAAAGGG + Intergenic
1203449056 Un_GL000219v1:93080-93102 CAGGCTTGACAGGAGCAAAAGGG + Intergenic
1186425411 X:9460956-9460978 CAGGGGTTCAAGGAGGAAGAAGG - Intergenic
1187251489 X:17602438-17602460 CAGGCTTTCAAGGATGAAAAGGG + Intronic
1188104441 X:26132478-26132500 CATGCTTATCAGGAGGCAGCAGG - Intergenic
1190023090 X:46897168-46897190 CAGGCTTACTAGGGAGAACATGG + Intronic
1191937164 X:66438253-66438275 TAGGCTTACCATGATGAAGGGGG - Intergenic
1193087638 X:77461334-77461356 CAGCCTTTTCAGGAGGAGGAAGG - Intergenic
1193563762 X:83052525-83052547 AAGGCTTACAAACAGGAAGAGGG - Intergenic
1197652556 X:129081752-129081774 CAGGCTAGCCATGTGGAAGATGG + Intergenic
1199102965 X:143827290-143827312 CAGGCTTCCTAGGATCAAGAGGG - Intergenic
1199568972 X:149248098-149248120 TAGGCTGAGGAGGAGGAAGAGGG + Intergenic
1200975405 Y:9207339-9207361 CAGGCTTGCCAGGTGTGAGAGGG + Intergenic
1201771944 Y:17623984-17624006 TAGGCCTACAAGGAGGAAGTGGG + Intergenic
1201829611 Y:18282002-18282024 TAGGCCTACAAGGAGGAAGTGGG - Intergenic
1202135745 Y:21659189-21659211 CAGGCTTGCCAGGTGTGAGAGGG - Intergenic