ID: 981055554

View in Genome Browser
Species Human (GRCh38)
Location 4:140357507-140357529
Sequence CATTCACTGCAGGAGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981055554_981055559 -6 Left 981055554 4:140357507-140357529 CCTGGCACCTCCTGCAGTGAATG 0: 1
1: 0
2: 0
3: 14
4: 196
Right 981055559 4:140357524-140357546 TGAATGCCACTGGATGGAAGTGG No data
981055554_981055562 27 Left 981055554 4:140357507-140357529 CCTGGCACCTCCTGCAGTGAATG 0: 1
1: 0
2: 0
3: 14
4: 196
Right 981055562 4:140357557-140357579 TGCATGTTCCTATTGCCATGTGG 0: 1
1: 0
2: 1
3: 10
4: 199
981055554_981055560 -5 Left 981055554 4:140357507-140357529 CCTGGCACCTCCTGCAGTGAATG 0: 1
1: 0
2: 0
3: 14
4: 196
Right 981055560 4:140357525-140357547 GAATGCCACTGGATGGAAGTGGG 0: 1
1: 0
2: 2
3: 16
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981055554 Original CRISPR CATTCACTGCAGGAGGTGCC AGG (reversed) Intronic
900587215 1:3439019-3439041 CATTCCCTGTTGGAGGTGCTGGG + Intergenic
902888623 1:19425200-19425222 CATTGTATGAAGGAGGTGCCTGG - Intronic
903172733 1:21563883-21563905 CATCCACAGCAGCAGGTGTCTGG - Intronic
912649811 1:111427648-111427670 CACTCAGTCCAGGAAGTGCCAGG - Intronic
913166627 1:116193090-116193112 CAAGCACTGCAGCAGGTGCTTGG - Intergenic
917149455 1:171929004-171929026 CAAACACTGTAGGAGGTGGCTGG + Intronic
918170980 1:181997204-181997226 CATTTACTGAAGGAGAGGCCAGG - Intergenic
918447666 1:184631081-184631103 CATTCCCTTTAGGAGGGGCCGGG + Intergenic
919055831 1:192569118-192569140 CAATCATGGCAGGAGGTGACAGG + Intergenic
919410152 1:197232672-197232694 CATTGACTGAAGGAGAGGCCAGG + Intergenic
919860293 1:201735424-201735446 CATTTCCTGCAGGAAGGGCCTGG + Intronic
923913498 1:238476807-238476829 CTCTCTCTACAGGAGGTGCCTGG - Intergenic
924742387 1:246802651-246802673 AATTCAAGGAAGGAGGTGCCAGG + Intergenic
1062862999 10:824667-824689 CAGGCACTGCAGGTGGAGCCTGG - Intronic
1063450255 10:6145769-6145791 CAGCCCCTGCAGGAGGGGCCGGG - Intronic
1063541763 10:6941276-6941298 GAGCCAGTGCAGGAGGTGCCTGG + Intergenic
1063877233 10:10492958-10492980 CAATCACGGCAGGAGGTGAAAGG - Intergenic
1064210938 10:13359997-13360019 CATACACAGCAGGTGGTCCCAGG - Intergenic
1065554720 10:26903970-26903992 CTTTCACTGCACGTGGTACCTGG - Intergenic
1070750658 10:78962263-78962285 CATTTACTCCAGGAGATGGCTGG - Intergenic
1070796732 10:79221325-79221347 CAGTCACTGCAGCAGCCGCCAGG + Intronic
1073065063 10:100753489-100753511 CACTCACTGTAGGAAGAGCCCGG + Intronic
1075048985 10:119168001-119168023 CATTCATTGCAGGAGTTACACGG + Exonic
1075160370 10:120019219-120019241 CATTCATAGCAGGAGGTGGGAGG + Intergenic
1076335491 10:129703839-129703861 CTCTTGCTGCAGGAGGTGCCAGG + Intronic
1076730339 10:132436049-132436071 CATCCAGTGGAGAAGGTGCCTGG - Intergenic
1076872341 10:133200180-133200202 CATTCACTGCTTGGGGTCCCTGG - Intronic
1077020085 11:413483-413505 GAAGCACTGCAGGAGATGCCAGG - Intronic
1077107547 11:848596-848618 CAGTCACTCCAGGAGGACCCAGG + Intronic
1078015687 11:7612276-7612298 CTTTGACTGCAGAAGTTGCCTGG - Intronic
1080944823 11:36958894-36958916 CATACACTGCACCAGGTGCCAGG + Intergenic
1084432081 11:69116773-69116795 CAGTCACTGCTGGAGGGGGCCGG - Intergenic
1090099885 11:123783080-123783102 CATTCACTGCTGCAGTTACCTGG - Intergenic
1091219587 11:133922184-133922206 CACCCACTGCAGGAAGAGCCTGG - Exonic
1094236754 12:28177011-28177033 CATTTCCTGCAGGAGGAGGCTGG + Intronic
1097449299 12:59716214-59716236 CATTGACTGCATGAGATGCAAGG - Intronic
1099198144 12:79643435-79643457 CATTCACGGCAGGGGGTACCTGG - Intronic
1103376205 12:120457986-120458008 CATTCAAAGCAGGAGGAGCATGG + Intronic
1104214888 12:126725777-126725799 CATTCACTGCAGGCAGGGTCAGG + Intergenic
1104498045 12:129259214-129259236 CACTCACTGCAGGAGGATCTAGG + Intronic
1105290975 13:19053197-19053219 CACACACGGCAGGAGCTGCCAGG + Intergenic
1107266549 13:38562318-38562340 GATACACAGCAGGTGGTGCCAGG - Intergenic
1107336702 13:39363153-39363175 CACTCACAGCTGGAGCTGCCTGG - Intronic
1111415673 13:87940410-87940432 CAATCATGGCAGGAGGTGACGGG - Intergenic
1113196754 13:107817486-107817508 CATTCACTCTAGGGAGTGCCGGG + Intronic
1114714103 14:24806456-24806478 TTTCCACTCCAGGAGGTGCCAGG + Intergenic
1119530244 14:75354977-75354999 CACTCCCTGCAGGAGGAGCTGGG - Intergenic
1123968975 15:25486813-25486835 AATTCACTGCAGGATAGGCCAGG - Intergenic
1129413436 15:75362020-75362042 CAATCCCTGCAGGAGAAGCCAGG + Intronic
1135121860 16:19773137-19773159 CATTCCCTACTGGAGGTGGCTGG + Intronic
1136403060 16:30028899-30028921 CAGACACTGCAGCAGCTGCCTGG + Intronic
1136573951 16:31112307-31112329 CATTCCCTGCAGGACCTCCCGGG + Exonic
1137072010 16:35911981-35912003 CTTTCACAGCAGCATGTGCCAGG + Intergenic
1137584824 16:49658172-49658194 CAGTCACTGCAGTATGGGCCAGG - Intronic
1137644117 16:50059410-50059432 CAGTCCCTGCAGCAGGTGCTAGG - Intergenic
1137705488 16:50532966-50532988 CTTACACAGCAGTAGGTGCCCGG - Intergenic
1139871678 16:70113495-70113517 TATTCAGTGGAAGAGGTGCCAGG + Intergenic
1140215063 16:73000490-73000512 CTTTAACTGAAGGATGTGCCAGG + Intronic
1140364257 16:74368988-74369010 TATTCAGTGGAAGAGGTGCCAGG - Intergenic
1141712025 16:85705237-85705259 CCTTCACTGCACGAGAGGCCAGG - Intronic
1141991981 16:87615734-87615756 CATTCAATGCAGGTGGTGCTGGG + Intronic
1142143100 16:88481302-88481324 CCCTCACTGCAGGTGGTCCCAGG + Intronic
1142282062 16:89153883-89153905 TGGTGACTGCAGGAGGTGCCCGG - Intronic
1142425744 16:90001392-90001414 CTTTCACTGCGGGATGTGTCTGG + Intergenic
1142670328 17:1485067-1485089 CTCTCAGTGGAGGAGGTGCCTGG - Intronic
1143419309 17:6776423-6776445 CTTTGGCTGCAGGAGTTGCCAGG + Intronic
1147205606 17:38835322-38835344 CATTCTCTCCAGCAGGTGACTGG - Exonic
1147558757 17:41496448-41496470 AAGTCACAGCAGGAGGTGCAGGG - Intergenic
1148677844 17:49455454-49455476 CATTCTTTGCCTGAGGTGCCCGG + Intronic
1148957981 17:51369811-51369833 CATTCACTGCAGGAGGGGAGGGG + Intergenic
1149128147 17:53260530-53260552 CAATCACTGCAGAAGGTGAAAGG - Intergenic
1151355999 17:73558892-73558914 CACTCACTGCAGTAGCGGCCTGG + Intronic
1152870974 17:82752695-82752717 CCGTCACTGGAGGAGGTCCCTGG + Intronic
1153574280 18:6504950-6504972 CAGTCACTTCAAGAGGTGGCTGG - Intergenic
1156053274 18:32965048-32965070 CAGTCACTGTTTGAGGTGCCGGG - Intronic
1160451186 18:78966859-78966881 TCTTCACTGTAGGAAGTGCCAGG + Intergenic
1160521249 18:79509385-79509407 CCTTCACTGTAGGAGGAGCTGGG + Intronic
1161258197 19:3321350-3321372 CAGCCGCTGCAGGAGGTGGCCGG + Intergenic
1161269726 19:3383156-3383178 CATTCACAGAAAGCGGTGCCAGG - Intronic
1161308327 19:3579154-3579176 CATTCCCTGCTGGGGGCGCCAGG + Intergenic
1162020954 19:7868432-7868454 CGTTCGGTGCAGGAGGGGCCTGG - Intergenic
1162057831 19:8075327-8075349 CATTCACAGCGGAAGCTGCCCGG + Exonic
1162304558 19:9864020-9864042 CATTCACTGCAGGTGTGCCCAGG + Intronic
1163514439 19:17754580-17754602 CTTTTCCTGCAGGAGCTGCCTGG + Exonic
1165016112 19:32881118-32881140 CATTCACTGCAGTCAGGGCCTGG - Intronic
1165349104 19:35267067-35267089 CACTGACTGCTGGAGGAGCCCGG - Intronic
925208687 2:2028266-2028288 CAGGCTCTGCAGGAGGAGCCTGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925238225 2:2297658-2297680 CATTCACTCCAGAAGGTTCCAGG + Intronic
925912250 2:8581552-8581574 CAACCCCTGCAGGAGGTGGCAGG - Intergenic
926046244 2:9711667-9711689 CAGTCACAGCGGGCGGTGCCAGG - Intergenic
926728447 2:16016115-16016137 CATTCACTGCAGGTCTTGCATGG + Intergenic
927427306 2:22995579-22995601 CCTGGGCTGCAGGAGGTGCCAGG - Intergenic
928115762 2:28544330-28544352 CAGTCCCTGCTGGAGGGGCCAGG - Intronic
928674685 2:33639023-33639045 CACTCACTGTAGCAGGGGCCTGG - Intergenic
929569228 2:43009538-43009560 AACTCACAGCAGGAGGTGACTGG + Intergenic
929833588 2:45373183-45373205 CATTCACTTCAGCAGTGGCCAGG + Intergenic
929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG + Intergenic
931239595 2:60440238-60440260 CATTCACTGGAGGATGTGGCGGG + Intergenic
931693030 2:64851487-64851509 CAGTCTCTGGAGGAGATGCCTGG - Intergenic
936254108 2:110894689-110894711 CCACCACTGCAGGAGGTGGCAGG - Intronic
937079955 2:119133744-119133766 CATGCACAGCAGGAAGTGGCAGG - Intergenic
937334991 2:121056843-121056865 CACACACTGCAGTAGGTGCTGGG + Intergenic
941000658 2:160199827-160199849 CATTCACTGTGGGAACTGCCCGG + Intronic
944476603 2:200112847-200112869 AATTCATTGCAGCTGGTGCCAGG + Intergenic
946518152 2:220435949-220435971 CTTTGAATGCAGGAAGTGCCTGG + Intergenic
946679942 2:222202890-222202912 CATTCACTGCTTTAGGTGCTGGG - Intronic
947739814 2:232479987-232480009 CCCTCACTTCAGGAGGGGCCTGG - Exonic
948087649 2:235264943-235264965 CCTGCACAGCAGGAGGTGCGTGG + Intergenic
948523147 2:238554309-238554331 GACTCACTGCTGGAGCTGCCAGG - Intergenic
948747956 2:240109546-240109568 CAGACCCTGCAGTAGGTGCCTGG - Intergenic
1170831298 20:19843702-19843724 CAGTAACTCCAAGAGGTGCCTGG + Intergenic
1172777392 20:37415449-37415471 GCTGCACTGCAGGAGGTGACAGG - Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1174097724 20:48102610-48102632 CAGGCACTGCATGGGGTGCCAGG - Intergenic
1175248261 20:57594149-57594171 CAGTCCCTGCAGGGGCTGCCAGG - Intergenic
1175478787 20:59296736-59296758 GATGCACTGGAGGAAGTGCCAGG - Intergenic
1175550103 20:59811942-59811964 CATTCTCAGCAGGGGGTGCTGGG + Intronic
1178960336 21:37059235-37059257 CATTCACGGCAGAAGGTGAAGGG + Intronic
1179354174 21:40643020-40643042 CAGAGACTGCAGCAGGTGCCAGG - Intronic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1179875618 21:44265918-44265940 CCTTTACTGCAGGAGGTTCTGGG - Intergenic
1185089036 22:48755683-48755705 CAGGCTGTGCAGGAGGTGCCAGG - Intronic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
949573039 3:5311780-5311802 CAATCACTGCCGGAGATGCCTGG + Intergenic
950140265 3:10610521-10610543 TATTCACTGCATGAGGTGAATGG + Intronic
950459388 3:13112228-13112250 CATTCACCACGGCAGGTGCCTGG + Intergenic
951470123 3:23046710-23046732 CAATCACAGCAGGAGGTGAAGGG - Intergenic
955146975 3:56329442-56329464 AATTCCCTGCAGGAGGAACCAGG - Intronic
956803929 3:72788931-72788953 CAAACACTGCAGAAGGTGGCAGG + Intronic
957428476 3:80070871-80070893 CAAACACTGCAGAAGGTGGCAGG + Intergenic
961028796 3:123584746-123584768 CATTCCCGGCGGGGGGTGCCCGG - Intronic
961623084 3:128239941-128239963 CATCGACTGCAGGAGGTGCTAGG - Intronic
963154546 3:142082010-142082032 GATGCACTGCAGGAGGTGAGTGG + Intronic
964203433 3:154144077-154144099 CTTTCACTGCAGCAGAAGCCAGG + Intronic
966733911 3:183173607-183173629 CAGTCATTGCTGGAGGTTCCTGG - Intergenic
968612371 4:1563161-1563183 CCTTCAGTCCAGGAGGTGTCTGG - Intergenic
968922047 4:3527350-3527372 CATTCCCAGCAGGAGGACCCAGG + Intronic
969180149 4:5434167-5434189 CTTTCACTGCATGGGGTGCATGG - Intronic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974133478 4:57786130-57786152 GAGTCACTGGATGAGGTGCCTGG + Intergenic
974222054 4:58987771-58987793 AATGCACTGTAGGAGGTGGCTGG - Intergenic
976132358 4:81898037-81898059 CATTCACTGTGGGAGGCCCCTGG - Intronic
977406322 4:96603841-96603863 CAGACACTGCAGCACGTGCCAGG + Intergenic
977445279 4:97123974-97123996 CATGCACTGCAGGAGGGGCTTGG - Intergenic
981055554 4:140357507-140357529 CATTCACTGCAGGAGGTGCCAGG - Intronic
984811697 4:183800980-183801002 CTTTCACAGCAGGATTTGCCAGG + Intergenic
985350424 4:189055546-189055568 CCACCACTGCAGGAAGTGCCAGG + Intergenic
985947191 5:3194977-3194999 CAGCCCCTGCAGAAGGTGCCTGG + Intergenic
986790010 5:11150266-11150288 CAATCACTGCAGGAGTAGGCGGG - Intronic
987242934 5:16019388-16019410 CACTCACATCAGGAGGTGGCGGG + Intergenic
991675166 5:69083575-69083597 CCTTTACAGCAGGAGGAGCCTGG + Intergenic
999167798 5:149565644-149565666 CAGTCACTGCACTAAGTGCCAGG + Intronic
1006302938 6:33203742-33203764 CAATCACTTCTGGAGGTGCTGGG + Exonic
1006412335 6:33881575-33881597 CAGGCTCTGCAGGGGGTGCCAGG - Intergenic
1008416711 6:51249217-51249239 CATTCCTTTCAGGAGGTTCCAGG + Intergenic
1008419357 6:51279328-51279350 CCTTCACTGCAGGAGTTCTCAGG + Intergenic
1013292586 6:108732165-108732187 TGTGCACTGCAGGAGGTGCCCGG + Intergenic
1013737985 6:113249263-113249285 CATTGGCTGCAGCAGGTGTCGGG - Intergenic
1015380621 6:132563353-132563375 CATCCAGTGCAGGAGGGACCAGG - Intergenic
1015907258 6:138129826-138129848 CATTCAAGGCAGTAGGTTCCAGG - Intergenic
1018717192 6:166542648-166542670 CAATGACTGCAGGAAGTCCCGGG + Intronic
1021624960 7:22583955-22583977 CAGTCACTGCATGAGTTCCCAGG - Intronic
1021813091 7:24422875-24422897 TATTCACTGCAGCATGTGTCAGG - Intergenic
1021973412 7:25986858-25986880 CTTTCTCTGGAGGAAGTGCCAGG - Intergenic
1023054705 7:36282449-36282471 CACTCCCTGCGGGAGGGGCCAGG - Intronic
1024102723 7:46049172-46049194 CATTGGCTGCTGGAGCTGCCAGG + Intergenic
1029646153 7:101857233-101857255 AATGCCCTGTAGGAGGTGCCCGG - Intronic
1032471930 7:132184992-132185014 CAGTGACTGCTGGGGGTGCCAGG - Intronic
1032500057 7:132393326-132393348 CATTCACTGCCTTAGGTGCTGGG - Intronic
1034941786 7:155235508-155235530 AATTCACTGCATGAGGAGCTGGG - Intergenic
1034969921 7:155412625-155412647 CATCCCATGCAGGAGGTGCCTGG + Intergenic
1036772705 8:11590061-11590083 CATCCACTGCAGGAGAAACCAGG + Intergenic
1037036986 8:14180325-14180347 CAAGCACTGCAGGAAGTGCTTGG + Intronic
1039576226 8:38626077-38626099 CCTTTCCTGCAGGAGGAGCCTGG - Intergenic
1040933921 8:52764038-52764060 CAGGCACTGCAGGAGGTGCTTGG + Intergenic
1042857417 8:73281761-73281783 TATTCTCTGGAGGAGGAGCCAGG - Intergenic
1042951431 8:74204153-74204175 CATTTCCTGCAGGAAGTGCTTGG - Intergenic
1043519141 8:81025721-81025743 CAGCCACAGGAGGAGGTGCCTGG + Intronic
1045117372 8:98998048-98998070 CATCCCCTGCAGGTGGTGCTGGG - Intergenic
1047632806 8:126726675-126726697 CATTAACTGAAGGAGAGGCCAGG + Intergenic
1048556732 8:135485212-135485234 CAGTCACTGCTGTAGGTGCTGGG - Intronic
1049576871 8:143393622-143393644 CACTCACAGCAGGGGGGGCCAGG + Intergenic
1052094673 9:24369719-24369741 CAAACACTGTAGGAGGTGGCTGG + Intergenic
1052271313 9:26631095-26631117 CAGTCACTGCAGGAGCCACCTGG + Intergenic
1053141367 9:35684802-35684824 CATTTACTGCAGGGGGTGTGTGG + Intronic
1053480518 9:38413307-38413329 CAAGCACTGGAGGAGCTGCCTGG - Exonic
1055526444 9:77138478-77138500 CACTCACGGCAGGAGGAACCAGG + Intergenic
1056072716 9:83005898-83005920 CATAGAATGCAGGAGCTGCCAGG - Intronic
1057270655 9:93648950-93648972 CACACACAGCAGGAGCTGCCAGG - Intronic
1057311059 9:93943550-93943572 CATTCACTGCAGGGCCTGACGGG + Intergenic
1057518541 9:95741608-95741630 CAGTCACTGCTGGACGGGCCAGG - Intergenic
1057781773 9:98056457-98056479 CATTCCCTGCAGGAGGCGGACGG - Intergenic
1059051028 9:110925742-110925764 CATTCACCGCAGCATGTGCCAGG + Intronic
1060471034 9:123948393-123948415 CAGTCAATGCAGGATGTCCCTGG + Intergenic
1060863715 9:126978030-126978052 CATTTTCAGCAGGAGGAGCCTGG - Intronic
1061259259 9:129470680-129470702 CACTCCCTGCAGGTGGTCCCTGG + Intergenic
1061389308 9:130308529-130308551 CATTCCTTGCAGCAGCTGCCTGG + Intronic
1061500257 9:130997821-130997843 CATTCAAGGCAGGATGTGACCGG - Intergenic
1061838951 9:133346851-133346873 CAGACACCGCAGGGGGTGCCAGG + Intronic
1185612622 X:1401733-1401755 CATTCCCTGGTGGAGGGGCCAGG + Intergenic
1187278929 X:17841760-17841782 CTTCCACTGCAGCAGGTGTCTGG - Intronic
1190906982 X:54737242-54737264 CAAACACTGCAGAAGGTGGCAGG + Intergenic
1195166381 X:102224595-102224617 CATTCACTGCATGTGGGGGCAGG + Intronic
1195192479 X:102462493-102462515 CATTCACTGCATGTGGGGGCAGG - Intronic
1196736581 X:118985956-118985978 CAAACACTGCAGGAGCTGCTGGG + Intronic
1200011783 X:153125598-153125620 CTTTCACTGCACAAGGCGCCTGG + Intergenic
1200011872 X:153125976-153125998 CTTTCACTGCACAAAGTGCCTGG + Intergenic
1200027729 X:153273943-153273965 CTTTCACTGCACAAAGTGCCTGG - Intergenic
1200027818 X:153274321-153274343 CTTTCACTGCACAAGGCGCCTGG - Intergenic
1200272539 X:154699318-154699340 TATTCACTGGGGGAGGTTCCAGG + Exonic