ID: 981056212

View in Genome Browser
Species Human (GRCh38)
Location 4:140364646-140364668
Sequence ACATCAGCTGCCAGTCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981056210_981056212 2 Left 981056210 4:140364621-140364643 CCTGAGCCTTGAAGGGAAAAGAA 0: 2
1: 9
2: 45
3: 87
4: 380
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167
981056206_981056212 25 Left 981056206 4:140364598-140364620 CCTTATCTATAAAGCTGCTCATC 0: 1
1: 5
2: 40
3: 78
4: 218
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167
981056211_981056212 -4 Left 981056211 4:140364627-140364649 CCTTGAAGGGAAAAGAAAAACAT 0: 1
1: 3
2: 52
3: 155
4: 930
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167
981056205_981056212 26 Left 981056205 4:140364597-140364619 CCCTTATCTATAAAGCTGCTCAT 0: 1
1: 9
2: 48
3: 87
4: 301
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167
981056209_981056212 3 Left 981056209 4:140364620-140364642 CCCTGAGCCTTGAAGGGAAAAGA 0: 12
1: 29
2: 58
3: 83
4: 309
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981056212 Original CRISPR ACATCAGCTGCCAGTCTTAA TGG Intronic