ID: 981056212

View in Genome Browser
Species Human (GRCh38)
Location 4:140364646-140364668
Sequence ACATCAGCTGCCAGTCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981056206_981056212 25 Left 981056206 4:140364598-140364620 CCTTATCTATAAAGCTGCTCATC 0: 1
1: 5
2: 40
3: 78
4: 218
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167
981056209_981056212 3 Left 981056209 4:140364620-140364642 CCCTGAGCCTTGAAGGGAAAAGA 0: 12
1: 29
2: 58
3: 83
4: 309
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167
981056205_981056212 26 Left 981056205 4:140364597-140364619 CCCTTATCTATAAAGCTGCTCAT 0: 1
1: 9
2: 48
3: 87
4: 301
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167
981056210_981056212 2 Left 981056210 4:140364621-140364643 CCTGAGCCTTGAAGGGAAAAGAA 0: 2
1: 9
2: 45
3: 87
4: 380
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167
981056211_981056212 -4 Left 981056211 4:140364627-140364649 CCTTGAAGGGAAAAGAAAAACAT 0: 1
1: 3
2: 52
3: 155
4: 930
Right 981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG 0: 1
1: 0
2: 0
3: 10
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981056212 Original CRISPR ACATCAGCTGCCAGTCTTAA TGG Intronic
900498599 1:2988500-2988522 TCAGCAGCTGCCAGTCTTTGTGG + Intergenic
900510251 1:3055869-3055891 ATTTCAGCTGACATTCTTAAAGG + Intergenic
902252785 1:15166292-15166314 ACATCAGCTGCCACTCCTGGTGG + Intronic
902728700 1:18354179-18354201 ACATCTGAGGCCAGCCTTAAAGG + Intronic
906073451 1:43034689-43034711 ACAGTAGCTGCCAACCTTAAAGG - Intergenic
908904035 1:68987253-68987275 AGATCCGCTGCTAGTCTTATGGG - Intergenic
909582506 1:77253780-77253802 ACATCAGCTGCTACAGTTAAGGG + Intergenic
912320532 1:108708728-108708750 ACCTCAGCTGCCAGTTCCAATGG + Intergenic
913040523 1:115018417-115018439 ACATCAGCTGTTAGTCTGATGGG + Intergenic
914996930 1:152552154-152552176 AGATCAGCTGCTAGTCTGATGGG + Intronic
916444138 1:164856282-164856304 ACATCAGGTGCAAATCTCAAGGG - Intronic
918889796 1:190252106-190252128 ATATCAGCTGCCAGTAATAAAGG - Intronic
924397653 1:243640482-243640504 GCATAAACTGCCAGGCTTAAAGG - Intronic
1063955697 10:11263681-11263703 AAGCCAGCAGCCAGTCTTAACGG + Intronic
1065603637 10:27394016-27394038 CCAACAGCTTCCTGTCTTAAAGG - Intergenic
1066595804 10:37048881-37048903 ACATCAGCTGTTAGTCTGATGGG + Intergenic
1066603829 10:37139004-37139026 ACATCAGCTGTTAGTCTGATGGG - Intronic
1066927397 10:41714811-41714833 ACATCAGCTGTTAGTCTGATGGG - Intergenic
1072498638 10:95989423-95989445 AAAACAGCTGCCAGTGATAAAGG - Intronic
1073049298 10:100657104-100657126 ACCTCAGCTGCCATGCTTCAGGG + Intergenic
1077637555 11:3854363-3854385 CCAACAGCTGCCTGGCTTAAGGG - Intergenic
1081556611 11:44168624-44168646 AAATCAGCTGACAATCTTACTGG - Intronic
1082145067 11:48657104-48657126 AGATCAGCTGTCAGTCTTATGGG + Intergenic
1082269149 11:50150616-50150638 AGATCAGCTGTTAGTCTTATGGG - Intergenic
1082279593 11:50257521-50257543 AGATCAGCTGTTAGTCTTATGGG + Intergenic
1085699990 11:78737314-78737336 ACATTAGTGGCCAGTCTTCAGGG - Intronic
1091580363 12:1783742-1783764 AAATTAGCTTCCAGTTTTAAAGG - Intronic
1094803617 12:34066744-34066766 AGATCAGCTGCTAGTCTGATGGG - Intergenic
1094805358 12:34084999-34085021 AGATCAGCTGCTAGTCTGATGGG - Intergenic
1098742136 12:74186214-74186236 AAATCTGCTGCTAGTCTTATTGG - Intergenic
1099392639 12:82099555-82099577 ACTTCAGCTGTCTGTTTTAAAGG - Intergenic
1100795250 12:98175337-98175359 GCAGCAGCTGCCAATCTAAAGGG + Intergenic
1102137256 12:110585718-110585740 AGGTCAGTTGCCACTCTTAAAGG + Intergenic
1102377635 12:112435828-112435850 ACATGAGCTGTCAGTGATAATGG + Intronic
1106019008 13:25897396-25897418 ACATCAGCTGTTAGTCTGATGGG + Intronic
1109630380 13:65037391-65037413 ACATGGCCTGCCAGTATTAATGG - Intergenic
1110876679 13:80518627-80518649 AGATCAGCTGCTAGTCTGATGGG - Intergenic
1110922416 13:81104819-81104841 ACATAAGCCACCAGTCTTCATGG + Intergenic
1112139236 13:96620029-96620051 ACATCACCTGCCAATCTCACAGG - Intronic
1114718057 14:24849527-24849549 ACATCAGCTGTATCTCTTAATGG + Intronic
1115743368 14:36411163-36411185 AGATCAGCTGTTAGTCTTATGGG - Intergenic
1115743648 14:36413475-36413497 AGATCAGCTGTTAGTCTTATGGG - Intergenic
1117613680 14:57510165-57510187 ACATGAGTTGCCAGACTAAAAGG + Intergenic
1123102421 14:105813931-105813953 ACATTAGCTGCCAGCCTCACTGG + Intergenic
1128152100 15:65369565-65369587 ACAGCAGCTTCCTGTCCTAATGG + Intronic
1130400167 15:83544876-83544898 AAATCTGCTGCCAGACATAATGG + Intronic
1136600392 16:31283082-31283104 AGATCAGCTGCTAGTCTGATGGG + Intronic
1136603060 16:31310058-31310080 AGATCAGCTGCCAGTCTGATGGG + Intronic
1138841384 16:60511948-60511970 CCATGACCTGCCAGACTTAATGG + Intergenic
1138853484 16:60658470-60658492 ACATCAGTTGCTATTCTTATAGG + Intergenic
1138887983 16:61104100-61104122 AGTTCAGCTGCCATGCTTAATGG - Intergenic
1140448169 16:75048546-75048568 ACATCAACTGCCACTTGTAAAGG - Intronic
1142214028 16:88822129-88822151 CCATCACCTGCCAGTTTTCAGGG - Intronic
1149581183 17:57751306-57751328 ACATCAGTTGTCAGTCTTAGGGG + Intergenic
1150540299 17:66089964-66089986 AAATCCGCTGCTAGTCTTATTGG - Intronic
1155272534 18:24154526-24154548 ACATCAGCAGCCAATGTCAAAGG + Intronic
1160622799 18:80182275-80182297 GCATCAGCTGCCACCCTTCAGGG - Intronic
1162190633 19:8943558-8943580 ACTTCGCCTGCCAGTCCTAAAGG - Exonic
1164110281 19:22150149-22150171 ACATCTGCTGCTAGTCTGATGGG - Intergenic
926277397 2:11414845-11414867 AGATAAGCTGCCAGTCTTCTTGG - Intergenic
926919668 2:17927875-17927897 ACCTCAGCTGCCAGTTTTCTGGG + Intronic
927301894 2:21525331-21525353 AGATCAGCTGTCAGTCTGATCGG + Intergenic
927306901 2:21583931-21583953 ACATCTGCTGTTAGTCTTATGGG - Intergenic
927596173 2:24400083-24400105 ACACCAGCTGCAAGTTTGAAGGG + Intergenic
928850483 2:35739612-35739634 CCATCTCCTGCCAGTCTGAATGG + Intergenic
930369842 2:50488658-50488680 ACATCACTTGTCAGTCTGAATGG + Intronic
930794160 2:55370093-55370115 ACAATAGATGCAAGTCTTAAGGG + Intronic
931093046 2:58907633-58907655 TCATAAGCTGCCAGTCTTAGAGG - Intergenic
931949374 2:67345250-67345272 ACAACAGCTGCTAATGTTAATGG + Intergenic
933715389 2:85355935-85355957 ACACCAGCAGCCAGTTTTTATGG + Intronic
935110836 2:100092766-100092788 ACATCTGATTGCAGTCTTAAAGG - Intronic
936124138 2:109772396-109772418 ACATCTGATTGCAGTCTTAAAGG + Intergenic
936220551 2:110599068-110599090 ACATCTGATTGCAGTCTTAAAGG - Intergenic
937614223 2:123901520-123901542 AAGTCAGCTGCCAGACTTATTGG + Intergenic
939625538 2:144472925-144472947 AGAGCAGCTGGCAGTCTCAATGG + Intronic
940131243 2:150385530-150385552 AAATCTGCTGCTAGTCTTATAGG + Intergenic
940809338 2:158224582-158224604 AGATCAGCTGTTAGTCTTATGGG - Intronic
942819215 2:180091400-180091422 ACATCAGCAGCCATATTTAACGG + Intergenic
944884928 2:204052900-204052922 AAATCTGCTGCCTGTCTTACAGG + Intergenic
945091924 2:206183670-206183692 ACATCTGCTGTAAGTCTTAGGGG - Intronic
947008955 2:225545043-225545065 ACATCTGCTGCCAGACTTATTGG + Intronic
1171904208 20:30887249-30887271 AGATCAGCTGTTAGTCTGAAGGG + Intergenic
1174920814 20:54699994-54700016 ACAACAGATGCCAGTGGTAAAGG + Intergenic
1176928616 21:14780677-14780699 AGATCAGCTGTTAGTCTTACGGG - Intergenic
1180337634 22:11593387-11593409 AGATCAGCTGTTAGTCTGAAGGG + Intergenic
1181632633 22:24159284-24159306 ACGTCAGCAGCCAGTTTCAAGGG - Intronic
1182184804 22:28391205-28391227 ACATCAGCTGTTAGTCTGATGGG + Intronic
1182351378 22:29701940-29701962 ACCTGAGCAGCCAGTATTAATGG - Intergenic
950721835 3:14888685-14888707 ACTTCAGCAGTCAGTCCTAAGGG - Intronic
952786663 3:37162240-37162262 ACATGAGGTGCCAGACTAAAAGG + Intronic
954415708 3:50392321-50392343 ACCACAGCTGCCAGGCTGAAAGG - Intronic
957514963 3:81238142-81238164 AAATCAGAAGCCAGTCTTAGTGG + Intergenic
962022998 3:131519329-131519351 ACATCAGATGCAAGGCTAAATGG - Intergenic
963269331 3:143270153-143270175 ACAACAGCTGCCCATCTGAAAGG - Intronic
963281904 3:143392229-143392251 ACATCAGCTGTTAGTCTGATGGG - Intronic
963438459 3:145304125-145304147 ATATCAGATGCCTGCCTTAAAGG - Intergenic
963606374 3:147414607-147414629 GCCTCTTCTGCCAGTCTTAAAGG + Exonic
963683828 3:148412750-148412772 AAATCAGCAGCCTGTTTTAATGG - Intergenic
970525686 4:16929499-16929521 ACTTCAGATGCCAGCCTGAAAGG - Intergenic
971605595 4:28653035-28653057 ACATCTGCAGCCAGTCCTTAGGG - Intergenic
972455320 4:39248130-39248152 AGATCAGCTGTTAGTCTGAAGGG - Intronic
973132601 4:46666337-46666359 AGATCAGCTGTCAGTCTGATGGG - Intergenic
976837420 4:89390972-89390994 AGATCAGCTGCTAGTCTGATGGG - Intergenic
977127115 4:93183944-93183966 AAATCAGCAGCAAGTCTTAGAGG + Intronic
980960365 4:139468914-139468936 ACATCTGCTGCCAGACCTATTGG + Intronic
981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG + Intronic
982481867 4:155921878-155921900 TAATCAGCTGCCAGTGTGAAAGG - Intergenic
982620105 4:157693260-157693282 AGATCAGCTGTCAGTCTGATGGG - Intergenic
986522453 5:8634432-8634454 ACCACAGCTGAGAGTCTTAATGG - Intergenic
986936692 5:12897072-12897094 AAATCAGGTGCCATTCTTAAAGG + Intergenic
989232379 5:39101283-39101305 ACTTCAGCTGCCAGTTTCACTGG - Intergenic
989564640 5:42889889-42889911 ACATCAGCTCCCATACTTAGTGG - Intergenic
990340231 5:54814726-54814748 AGATCAGCTGGCAGTCTGATGGG - Intergenic
992196924 5:74349463-74349485 ACATCTGCTGCTAGTCTGATGGG + Intergenic
992634234 5:78711511-78711533 AGATCAGCTGTTAGTCTTATCGG - Intronic
992803935 5:80318502-80318524 AAATTTGCTTCCAGTCTTAAGGG - Intergenic
993074476 5:83211284-83211306 ACAGCAGTTGCCAGTCCTCATGG - Intronic
993263002 5:85684784-85684806 AGATTAGCTGCCACTCTAAATGG - Intergenic
993773968 5:91967940-91967962 ACAGCAGCTTTCAGTCTCAAAGG - Intergenic
994194975 5:96912864-96912886 ACTTCAGCCACCAGTTTTAAAGG + Intronic
994729543 5:103475647-103475669 ACATCAGCTACCTGGCTTAAGGG + Intergenic
996320134 5:122206183-122206205 ACATCAGCTGTTAGTCTGACGGG - Intergenic
996428335 5:123339805-123339827 AGATTAGCTGCTAGTCATAAGGG - Intergenic
1000672652 5:164081263-164081285 ACATCACATGCCAGTCTCACTGG - Intergenic
1003494725 6:6654004-6654026 ACATCAGCTTCCACTCTGAAAGG - Intronic
1005840347 6:29741105-29741127 ACATCTGCAGCCAGTGTTTAGGG - Intergenic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1007858891 6:44886395-44886417 AGATCAGCTGTCAGTCTGATGGG - Intronic
1009863348 6:69364427-69364449 ACAACAGCTTCCAGCCTTCATGG + Intronic
1010093183 6:72008101-72008123 AGATCAGCTGCTAGTCTGATGGG - Intronic
1010255138 6:73748895-73748917 ACATCAGCTGACACTTTTACAGG + Intronic
1010599173 6:77802835-77802857 ACATCAGCTGTTAGTCTGATGGG + Intronic
1011016046 6:82756964-82756986 AGATCAGCTGTTAGTCTGAAGGG + Intergenic
1011884789 6:92080068-92080090 AGATCTGCTGTTAGTCTTAAGGG - Intergenic
1014640510 6:123903844-123903866 ACAACAGCTGCCAATTTTCAAGG - Intronic
1015191554 6:130477280-130477302 AGATCAGCTGTCAGTCTGATGGG - Intergenic
1016463861 6:144306690-144306712 ACTCCAGCTGCCAGTTTTCAAGG - Intronic
1016656751 6:146526959-146526981 CCAGCAGCTGCTATTCTTAAAGG + Intergenic
1017893601 6:158659844-158659866 ACATCAGCAGCCAGTGAAAAAGG - Intronic
1019102179 6:169640528-169640550 ACAGCAGCTGCAAGACTCAAAGG + Intronic
1019810696 7:3163183-3163205 ACATCAGCTGAAAGTCCCAAGGG + Intronic
1021373711 7:19882007-19882029 ACATCAGCTGTTAGTCTGATGGG + Intergenic
1021937731 7:25647649-25647671 ACATCTGATGGCAGTTTTAAAGG + Intergenic
1026364618 7:69635346-69635368 AAAGCACCTGCCAGTTTTAAGGG + Intronic
1026573571 7:71553390-71553412 ACATCATCTGACAGTCTCAGAGG + Intronic
1028723133 7:94057076-94057098 ACCTCAGCTGCCATTTTAAAAGG - Intergenic
1029372350 7:100157999-100158021 AGATGAACTGCCGGTCTTAAAGG - Intronic
1031606075 7:123769588-123769610 CCATCAGCTGCCAGCCTTTTCGG - Intergenic
1031617307 7:123896263-123896285 ACATCAGCTGTTAGTCTGATGGG - Intergenic
1031880791 7:127196040-127196062 ACATCACCTACAAGTATTAATGG + Intronic
1032708091 7:134439550-134439572 GCATCACCTGCCAGCCTTGAGGG + Intergenic
1033011780 7:137630629-137630651 ACATCAGTTGCCATTGTTATAGG - Intronic
1033946960 7:146730911-146730933 ACATCAGCTTCCATTTTCAAAGG + Intronic
1037488426 8:19373158-19373180 ACTTGTGCTTCCAGTCTTAAAGG - Intronic
1039596869 8:38798204-38798226 GCCTCAACTCCCAGTCTTAAGGG + Intronic
1044169074 8:89026658-89026680 AGATCAGCTGTCAGTCTGATGGG + Intergenic
1045088367 8:98711912-98711934 AGATCAGCTGTCAGTCTGATGGG - Intronic
1047127206 8:121975828-121975850 ACTTCAGCTGCTAGAATTAAGGG - Intergenic
1048731887 8:137451333-137451355 ACATCAGCTGCGTGACTTTAAGG + Intergenic
1052645762 9:31231368-31231390 ACATCAGCTGTCTATCTGAAAGG + Intergenic
1054790680 9:69253753-69253775 ACTTCAGCTTCCAGTCAGAATGG - Intronic
1055790944 9:79922454-79922476 ACATCAACTGCAAGTCTAGAGGG - Intergenic
1056909782 9:90688036-90688058 ACATCAGCTGTTAGTCTGATGGG - Intergenic
1057115131 9:92513658-92513680 ACATTAGAAGCCAGTCTGAAAGG + Intronic
1190336256 X:49264381-49264403 ATGTCAGCTGCCAGTCTTTATGG - Intronic
1191082269 X:56525245-56525267 ACATCAGCTGTTAGTCTGATGGG - Intergenic
1191093365 X:56648111-56648133 ACATCCGCTGTCAGTCTGATGGG - Intergenic
1192931270 X:75809165-75809187 ACATCAGCTGTTAGTCTGATGGG + Intergenic
1193051203 X:77101773-77101795 ACATCAGCTGTTAGTCTGATGGG + Intergenic
1193070820 X:77303778-77303800 TCATCAACTGCCACTCTCAAGGG + Intergenic
1194258392 X:91663336-91663358 GCACCAGCTGCCAGTCTTTTGGG - Intergenic
1194624958 X:96216293-96216315 AGATCCGCTGCCAGTCTGATGGG - Intergenic
1195163529 X:102195417-102195439 ACATCAGCTGTTAGTCTGATGGG + Intergenic
1195736022 X:108013173-108013195 ACATCAGCTGTTAGTCTGATGGG - Intergenic
1200577159 Y:4902831-4902853 GCACCAGCTGCCAGTCTTTTGGG - Intergenic
1201302584 Y:12522757-12522779 AGATCAGCTGTTAGTCTGAAGGG + Intergenic
1202089151 Y:21171136-21171158 ACATCAGCTGTTAGTCTGATGGG + Intergenic
1202105184 Y:21356171-21356193 ACATCAGCTGTTAGTCTGATGGG - Intergenic