ID: 981061269

View in Genome Browser
Species Human (GRCh38)
Location 4:140427623-140427645
Sequence AGTCGCTGCTGCGCGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981061269_981061274 6 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061274 4:140427652-140427674 CGCGCGTGCGCGTGCGGTGGCGG 0: 1
1: 0
2: 3
3: 22
4: 177
981061269_981061276 10 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061276 4:140427656-140427678 CGTGCGCGTGCGGTGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 165
981061269_981061272 3 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061272 4:140427649-140427671 AACCGCGCGTGCGCGTGCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 30
981061269_981061280 20 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061280 4:140427666-140427688 CGGTGGCGGGCGGGAGGCGGTGG 0: 1
1: 1
2: 27
3: 168
4: 1334
981061269_981061281 23 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061281 4:140427669-140427691 TGGCGGGCGGGAGGCGGTGGCGG 0: 1
1: 0
2: 9
3: 122
4: 1181
981061269_981061275 7 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061275 4:140427653-140427675 GCGCGTGCGCGTGCGGTGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 161
981061269_981061279 17 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061279 4:140427663-140427685 GTGCGGTGGCGGGCGGGAGGCGG 0: 1
1: 1
2: 11
3: 386
4: 8779
981061269_981061271 0 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061271 4:140427646-140427668 ACTAACCGCGCGTGCGCGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 8
981061269_981061282 30 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061282 4:140427676-140427698 CGGGAGGCGGTGGCGGCCCGAGG 0: 1
1: 0
2: 10
3: 67
4: 477
981061269_981061277 11 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061277 4:140427657-140427679 GTGCGCGTGCGGTGGCGGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 203
981061269_981061278 14 Left 981061269 4:140427623-140427645 CCGGCGGCCGCGCAGCAGCGACT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 981061278 4:140427660-140427682 CGCGTGCGGTGGCGGGCGGGAGG 0: 1
1: 0
2: 3
3: 43
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981061269 Original CRISPR AGTCGCTGCTGCGCGGCCGC CGG (reversed) Exonic
900362025 1:2293743-2293765 GGTGGCTGCTGCCCGGCCTCTGG + Intronic
900413867 1:2526264-2526286 GGTCGCTGATGCGCGGGCTCGGG - Intronic
901040242 1:6359144-6359166 GGCCGCTGCTGAGCGGCCTCAGG + Intronic
902465235 1:16613386-16613408 AGGCGCGGCGGCGCGGCTGCCGG - Exonic
903044183 1:20553396-20553418 AGTAGGTGATGCGCGGCAGCAGG - Exonic
903155568 1:21440277-21440299 AGGCGCGGCGGCGCGGCTGCGGG + Intronic
903907168 1:26695812-26695834 CGAGGCTGCTGCGCGGCAGCGGG - Intergenic
904041926 1:27590256-27590278 ACTCGCTGCTGCCTGGCCCCAGG - Intronic
906525269 1:46489925-46489947 AGTCGCTGCAGGGAGGACGCGGG + Intergenic
907429936 1:54405913-54405935 AGTGGCGGCCGCGCCGCCGCCGG - Intronic
910963394 1:92784885-92784907 AGACGCGGCGGCGCGGCTGCCGG - Intronic
918311631 1:183289437-183289459 AGTCTCTGCAGCCCGGCCACAGG + Intronic
921190063 1:212700399-212700421 AGCCGCGGCTTCGGGGCCGCTGG - Intergenic
922576617 1:226665168-226665190 AGTGGCTGCTGCTCAGCCCCAGG - Intronic
922748241 1:228059171-228059193 AGTAGGTGTAGCGCGGCCGCAGG - Exonic
1063375552 10:5552266-5552288 AGCCGCTGCTGCGGGGGCGGGGG + Intergenic
1073252977 10:102133317-102133339 AGTCGATGCCGGGTGGCCGCGGG + Intronic
1077016335 11:400595-400617 AGCCGCTGCAGCGCGGACGGCGG - Exonic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1095049505 12:37543725-37543747 AATGGCAGCTGCGCGGCGGCAGG - Intergenic
1096495492 12:52037249-52037271 AGCGGCTGCGGCGCGGCTGCAGG + Intronic
1099989492 12:89708325-89708347 AGTCGCTGCTCCGGGCCCGAGGG - Intronic
1102678579 12:114674665-114674687 TTTCGCTGCTGAGCGGCCCCGGG - Exonic
1104887447 12:132118968-132118990 AGACGCTGCAGCGCGGACCCCGG - Intronic
1105935615 13:25095915-25095937 TGGAGCTGCTGCGGGGCCGCTGG - Exonic
1108542586 13:51457299-51457321 AGTGGCTGCTGCCCTGACGCTGG - Intergenic
1118854765 14:69612059-69612081 AGTGGGGGCTGCGCGGCCGGGGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1129260725 15:74365801-74365823 AGTGGATGCTGCAGGGCCGCAGG + Intronic
1130935568 15:88467656-88467678 AGTCACAGCTGCGCCGGCGCCGG - Exonic
1132984341 16:2756432-2756454 TGTCCCTGGTGCGGGGCCGCCGG + Exonic
1135135773 16:19884732-19884754 CGTCGGCGCTGCGGGGCCGCGGG - Exonic
1139459450 16:67110123-67110145 GGTCCCTTCTGCGCTGCCGCAGG + Exonic
1141570190 16:84929494-84929516 AGTGGATGCTGCGATGCCGCCGG + Intergenic
1143958866 17:10697710-10697732 GGGCGGTGCTGCGGGGCCGCGGG + Intronic
1145370131 17:22300823-22300845 AATGGCTGCTGCGCCGCTGCAGG - Intergenic
1147110260 17:38256774-38256796 AGTCGGGGCTGGGCGGCCGCAGG - Intergenic
1148268356 17:46244096-46244118 AGTCTCTGAAGCACGGCCGCAGG - Intergenic
1148419252 17:47531657-47531679 GGTCGGGGCTGGGCGGCCGCAGG + Intronic
1149685378 17:58531856-58531878 AGCCGCGGCTGCGGTGCCGCGGG + Intronic
1150643490 17:66964687-66964709 AGTGCGGGCTGCGCGGCCGCCGG - Intergenic
1151235940 17:72719881-72719903 AGACGCTGCTGCCCGGCGGATGG + Intronic
1151559155 17:74861527-74861549 AGTCTCAGCTCCGCGGGCGCCGG + Intergenic
1152222137 17:79074799-79074821 AGTCCCCGCCGCGCGGCCGCTGG + Intergenic
1152297153 17:79474753-79474775 AGTCCCTGCTGCCCGCCCACTGG + Intronic
1155519851 18:26656923-26656945 AGCCGCGGCGGAGCGGCCGCGGG + Intronic
1163678613 19:18668114-18668136 CGTGGCTGGCGCGCGGCCGCCGG - Exonic
926251101 2:11155801-11155823 CGTCGCAGCTGGGCGGCCGAGGG + Intronic
926718545 2:15942459-15942481 AGAAGCTGCAGCACGGCCGCGGG + Exonic
929599310 2:43194969-43194991 ATTGGCTGCTGCACGGCTGCAGG + Intergenic
937119492 2:119431874-119431896 CGAGGCTGCAGCGCGGCCGCCGG + Exonic
937996970 2:127701586-127701608 AGCAGCGGCTCCGCGGCCGCCGG - Exonic
946029703 2:216694482-216694504 ACGCCCTGCTGCACGGCCGCGGG - Exonic
948479264 2:238239991-238240013 GGCTGCTGCTGGGCGGCCGCGGG - Exonic
1169483442 20:6006221-6006243 AGACCCCGCGGCGCGGCCGCAGG + Exonic
1174358722 20:50015110-50015132 CGCGGCTGCTGCGGGGCCGCTGG - Intergenic
1175368244 20:58469982-58470004 AGTCGCTGCTTTGCGGCCAATGG - Intronic
1176412191 21:6455069-6455091 AGGCTCTGCTGCTCCGCCGCAGG - Intergenic
1177905200 21:26965873-26965895 AGCCACTGCTGCGCGGACCCTGG - Exonic
1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG + Exonic
1179687685 21:43063391-43063413 AGGCTCTGCTGCTCCGCCGCAGG - Intronic
1183931542 22:41238514-41238536 AGGGGCTACTGCGCGTCCGCTGG - Exonic
950253897 3:11488420-11488442 AGCCGCCGCTGCCCGACCGCCGG - Intronic
953385037 3:42501653-42501675 AGGGGCGGCTGCTCGGCCGCTGG - Intronic
953748729 3:45594119-45594141 AGTCCCTGCTGCTCGCTCGCCGG - Intronic
961313323 3:126017509-126017531 AGTCACTGCTGCGGGGGCCCAGG + Intronic
966696278 3:182793513-182793535 GGTGGCTGCGGCGCGGCGGCAGG + Exonic
967884582 3:194324371-194324393 AGTCGCTGCTGCATGGCGGAGGG - Intergenic
969253841 4:5989567-5989589 AGCCCCTGCTGCCCGGCTGCAGG + Exonic
976281989 4:83334810-83334832 ACTCTCCGCTGCGCGGCAGCTGG - Exonic
981061269 4:140427623-140427645 AGTCGCTGCTGCGCGGCCGCCGG - Exonic
992549110 5:77844769-77844791 GGTCGCTGCTGCGCGGCGTGGGG + Intronic
1002418000 5:179130711-179130733 GGTGGCTGCTGCGGGGCAGCTGG + Intronic
1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG + Intronic
1019111887 6:169723874-169723896 GGTCGCTGTCGCACGGCCGCGGG + Exonic
1019828545 7:3302399-3302421 AGTGGGTGCTGCGCGGCCGGTGG + Intronic
1020136950 7:5592900-5592922 AGAGGCCGCTGCGCGGCCCCGGG - Exonic
1024089059 7:45920805-45920827 AGGCGCTGCTGGACGGCCGCGGG - Exonic
1032834959 7:135663781-135663803 AGTAGCTGGTGCGCGCCAGCAGG + Intronic
1033144991 7:138863685-138863707 AGTCGCTGCTTCACGGCAGTTGG - Intronic
1034197912 7:149262260-149262282 CGTCGCTGCCGCGCCGCCCCGGG + Exonic
1034436030 7:151063158-151063180 GGCCGCTGCTCCGCGCCCGCAGG + Intronic
1035052117 7:156004998-156005020 AGTCGGTGCTGCCGGGGCGCAGG + Intergenic
1037305267 8:17497397-17497419 ACTCGCTGGAGCGCGGCCTCAGG - Intronic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1042137352 8:65644951-65644973 AGTCTCTGCCTCCCGGCCGCGGG - Intronic
1043844960 8:85152947-85152969 AGCCCCTGCTCCGCGGCCCCTGG + Intergenic
1044320097 8:90791791-90791813 AGCTGCTGCTTCGCCGCCGCCGG - Exonic
1045059281 8:98398222-98398244 AGTAGCTGCTGCATGGCCTCGGG - Intergenic
1045277632 8:100721846-100721868 TGGAGCTGCTGCGGGGCCGCGGG + Exonic
1052970091 9:34372113-34372135 TGGCGCTGCGGCGCGGCCGGCGG + Exonic
1060601267 9:124879572-124879594 ATTCTGTGCTGCGCTGCCGCTGG - Exonic
1061961740 9:133992249-133992271 AGTGGCGGCAGTGCGGCCGCTGG - Exonic
1185736624 X:2500833-2500855 AGCTGCTGCGGCGCTGCCGCGGG - Exonic
1186350113 X:8731931-8731953 CGCGGCTGCTGCGCGGCGGCTGG - Exonic
1186463363 X:9765659-9765681 TGCAGCTGCTGCCCGGCCGCCGG - Exonic
1192656938 X:73002819-73002841 TGTGGCTGCTGCGGGGCTGCGGG - Intergenic
1192665182 X:73080182-73080204 TGTGGCTGCTGCGGGGCTGCGGG + Intergenic