ID: 981066565

View in Genome Browser
Species Human (GRCh38)
Location 4:140492298-140492320
Sequence ACTGGGACATTTGGAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981066565_981066571 14 Left 981066565 4:140492298-140492320 CCTTCAGCTCCAAATGTCCCAGT 0: 1
1: 0
2: 2
3: 19
4: 203
Right 981066571 4:140492335-140492357 ATTATAGATAAACTGCCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981066565 Original CRISPR ACTGGGACATTTGGAGCTGA AGG (reversed) Intronic
902311932 1:15587570-15587592 CATTGGACATGTGGAGCTGAGGG - Intronic
902695980 1:18141119-18141141 GCTGGGACAAGTGGAACTGAAGG + Intronic
909030612 1:70534633-70534655 ACTGGTAGATTTTGAGGTGAGGG + Intergenic
910367761 1:86484924-86484946 GCTGGAACATTGGGAGTTGAAGG + Intronic
910375197 1:86561167-86561189 ATTGGGACATGAGGAGATGATGG - Intronic
913680609 1:121185281-121185303 ACTGGGAGATTTGGAGAGGGTGG - Intronic
914032440 1:143972923-143972945 ACTGGGAGATTTGGAGAGGGTGG - Intergenic
914157005 1:145095044-145095066 ACTGGGAGATTTGGAGAGGGTGG + Intronic
914925821 1:151885780-151885802 AGTGGGATATTTGGATCAGAGGG + Intronic
916608001 1:166362067-166362089 ACTGGGGTAATTGGAGGTGATGG - Intergenic
916727072 1:167532980-167533002 CCTGGGACTGTTGGAGGTGATGG + Intronic
918533762 1:185551650-185551672 ATTGGGACTTTGGGAGGTGAGGG + Intergenic
920467920 1:206203807-206203829 ACTGGGAGATTTGGAGAGGGTGG - Intronic
920784008 1:209023021-209023043 ACTGGCAAATATGGAGGTGAGGG - Intergenic
923450815 1:234115735-234115757 ACTGAGATATTTCGAGGTGAAGG - Intronic
924443278 1:244104388-244104410 ACTGGGACAGCTGAAGCTGGGGG - Intergenic
1063514570 10:6682728-6682750 ATTTGGACATTTGGAGATAACGG - Intergenic
1065240126 10:23695728-23695750 ACTGGGGAGTTTGGAGCTGGGGG + Intronic
1066589338 10:36976802-36976824 AATTGAACACTTGGAGCTGAAGG - Intergenic
1066984745 10:42454829-42454851 GCAGGGACATTTTGAGCTGTGGG - Intergenic
1067325733 10:45264355-45264377 ACTGGGAAAGTTGGGGCTTAGGG - Intergenic
1070280905 10:75047523-75047545 ACAGGGGCATTTTGAGGTGATGG + Intronic
1071445147 10:85738874-85738896 GGTGGGACATTTGGGGCTAATGG + Intronic
1072682971 10:97520086-97520108 ACTGAGACATTTAGAGGTTAAGG - Intronic
1075234073 10:120710801-120710823 ACAGGGGCAGTGGGAGCTGAGGG - Intergenic
1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG + Intronic
1075746285 10:124730214-124730236 TCTGGGCCATTTGGGCCTGATGG - Intronic
1076872513 10:133200769-133200791 ACTGGGACAGTGGGAGCCGCCGG + Intronic
1077586522 11:3458022-3458044 ACTGGGACATGTGGAACTCCAGG + Intergenic
1077808515 11:5613560-5613582 ACTGGGACCTATGGGGCTGGTGG + Intronic
1078529717 11:12127608-12127630 ACTGGGACTTTGGGAGCACAGGG + Intronic
1083154040 11:60811492-60811514 CCTAGGACATTTGGAGGTGGCGG - Intergenic
1083647178 11:64178888-64178910 GTTGGGCCATTTGGATCTGAGGG + Intergenic
1084115340 11:67039909-67039931 ACTGGGGCCTCTGGAGCTGATGG + Exonic
1084861603 11:72022369-72022391 CCTGGGACTTTTGGAGCTCATGG + Exonic
1085898736 11:80671144-80671166 AATTGAACAGTTGGAGCTGAAGG + Intergenic
1086338229 11:85821422-85821444 ACAGGGACAACTGGAGGTGAAGG + Intergenic
1086745521 11:90422081-90422103 ACAGGGTTATTTTGAGCTGAAGG + Intergenic
1089589254 11:119530054-119530076 CATGGGACATTAGGTGCTGATGG - Intergenic
1089813739 11:121153497-121153519 ACTGGAAAATATGGAGCTGGAGG + Intronic
1092090578 12:5800381-5800403 ACTGGGAGATTTGCAGTAGAGGG + Intronic
1092412748 12:8266759-8266781 ACTGGGACATGTGGAACTCCAGG + Intergenic
1094159792 12:27378546-27378568 TGTGGAACATTTGGAGCTGTCGG + Intronic
1096602995 12:52743443-52743465 ACTGAGCCATTTGGAGCTCTTGG + Intergenic
1100430737 12:94529884-94529906 ACTGGGATATATGTAGCTAATGG - Intergenic
1100450687 12:94702902-94702924 ACTGGCAGATCTGGAGATGACGG + Intergenic
1101101153 12:101394038-101394060 ACTGGAACATTTGTAGCTGAAGG + Exonic
1101499851 12:105293018-105293040 AAAGAGACATTTGGAACTGAGGG + Intronic
1102393245 12:112566722-112566744 ACTGGGACAAATGTAACTGAAGG + Intergenic
1104644159 12:130485268-130485290 ACTGTGTCATTTGAGGCTGAGGG + Intronic
1107773280 13:43811245-43811267 AATGGCACATTTGGGGCTGGAGG - Intergenic
1108915870 13:55610438-55610460 ACTGGTACATTTGATGGTGAAGG - Intergenic
1114153708 14:20074771-20074793 ACTGGGAAAGTTGTGGCTGAAGG - Intergenic
1119501497 14:75131805-75131827 ACTGGGACATTTTGTGCTTTTGG - Exonic
1122047183 14:99032496-99032518 CATGGTACATTTGAAGCTGAGGG - Intergenic
1125435228 15:39637142-39637164 TCTGGGTTAGTTGGAGCTGAAGG - Intronic
1126373347 15:47970164-47970186 ACTGGGACAATGGGCTCTGAAGG + Intergenic
1126433542 15:48612295-48612317 ATGGGGAAATTTAGAGCTGAAGG - Intronic
1128908909 15:71494355-71494377 ACTGAGACATTTAGAGCACAAGG - Intronic
1129467954 15:75734361-75734383 ACAGAGACATTTGGGGCTGTGGG + Intergenic
1129719304 15:77869370-77869392 ACAGAGACATTTGGGGCTGTGGG - Intergenic
1130089114 15:80804596-80804618 CCTGGGACATCTGGAGCAGTAGG - Intronic
1130459621 15:84151480-84151502 ACAGAGACATTTGGGGCTGTGGG + Intergenic
1130741292 15:86603273-86603295 ACTGGGTCCTTTGGAGGGGAAGG - Intronic
1133353952 16:5122254-5122276 ACTGGGACATGTGGAACTCCAGG + Intergenic
1137798790 16:51243679-51243701 AATGGGAGATTTGGAGGTGATGG + Intergenic
1137904812 16:52310339-52310361 GCTTTGACATTTGGGGCTGAAGG - Intergenic
1138308789 16:56005376-56005398 ACAGTTACATGTGGAGCTGAGGG - Intergenic
1138452884 16:57104254-57104276 ACTGAGACATAGGGAGTTGAAGG + Intronic
1139401731 16:66687413-66687435 CCTTGGACTTTGGGAGCTGAAGG + Intronic
1140135262 16:72200026-72200048 AGTGTGACATTTGGATCTGGAGG + Intergenic
1140210847 16:72968830-72968852 ACTGGTATATTTAGAGGTGAAGG + Intronic
1141318742 16:82986834-82986856 ACTGGGAAATTTGGAGTTCCAGG - Intronic
1142954578 17:3512787-3512809 ACTGTGAATTTTGAAGCTGAAGG - Intronic
1143449088 17:7024992-7025014 CCTGGGAAATTTGGAGCCAAAGG - Intronic
1145282942 17:21480932-21480954 ACAGGGAGGTCTGGAGCTGAGGG - Intergenic
1145290390 17:21540673-21540695 ACTGGTACATTTGAAGAGGAGGG + Intronic
1147534855 17:41313615-41313637 ACTGGGAATTTTGGGGGTGATGG + Intergenic
1148461559 17:47841555-47841577 GCTGGGACATCTGGAGATTAAGG + Intergenic
1153908483 18:9685398-9685420 AGTGGGACACTTAGAGCAGAGGG - Intergenic
1157555618 18:48611127-48611149 ACTGGGACCTTGGGGGCTGAAGG - Intronic
1157578720 18:48760895-48760917 CATTGGGCATTTGGAGCTGAGGG + Intronic
1157810957 18:50695497-50695519 AAGGGGTCATTTGGAGCTGGAGG + Intronic
1159076657 18:63688406-63688428 ACTGGGAGGTTTGGACTTGATGG + Intronic
1159917884 18:74202475-74202497 GCTCAGAGATTTGGAGCTGAGGG + Intergenic
1160032398 18:75273833-75273855 AATGGGACAACTGGATCTGATGG - Intronic
1160866782 19:1259720-1259742 GCCGGGAGGTTTGGAGCTGAAGG - Intronic
1167112427 19:47470147-47470169 ACTGGACCATTTTGAGGTGATGG - Intronic
1167980736 19:53272906-53272928 GCTGGGACATTTGAAGGAGAAGG + Intergenic
927397894 2:22675372-22675394 TCTGGTATATTTGGAGCTCAGGG - Intergenic
928021954 2:27712403-27712425 ACTGGGAACGTTGGAGCTGAGGG + Intronic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
931184049 2:59932458-59932480 ACTGTGATCTTTGGAGCTCAGGG - Intergenic
931700143 2:64902757-64902779 CCTTGGACATGTGGAGGTGAGGG - Intergenic
933321347 2:80779360-80779382 ACTGGGGCATTGGGAGGTGGTGG - Intergenic
933391285 2:81671340-81671362 GCTGGGACATGTAGAGCTGATGG + Intergenic
936242238 2:110797787-110797809 GGTGGGATATTTGGAGATGAGGG + Intronic
939187112 2:138873686-138873708 ACTGGGGCCTCTGGAGCTGCAGG - Intergenic
941145547 2:161839720-161839742 ACTGGGACATTTTAAGCTCAGGG + Intronic
941604210 2:167576886-167576908 GCTGTGATATTTGGAGTTGAAGG - Intergenic
942696616 2:178653816-178653838 CCTGGGACAATTGGAGCTTCTGG + Exonic
942697495 2:178662337-178662359 CCTGGGACAATTGGAGCTTCTGG + Exonic
945946984 2:216003966-216003988 ACTGGCAGGTTTTGAGCTGAGGG - Intronic
946164758 2:217857238-217857260 CCTGGGGCTTTTAGAGCTGAAGG + Intronic
947033517 2:225824920-225824942 ACTGGGAGGTTTGGACCGGATGG + Intergenic
948498942 2:238376947-238376969 ACTGGGGCATTTGGAGGTTAAGG + Intronic
1170542803 20:17406114-17406136 ACATGGACATTTGGAGCAGGTGG - Intronic
1170897055 20:20424214-20424236 ACTGGGAGAATTGGAGAAGATGG - Intronic
1173129591 20:40377822-40377844 AATGGGACATTTGGAGCTGGAGG - Intergenic
1173716282 20:45209500-45209522 GCTGGTACAGTTGGAGCTGAAGG + Intronic
1174676380 20:52361016-52361038 GAGGAGACATTTGGAGCTGATGG - Intergenic
1174797564 20:53534991-53535013 ACTGTGACATTTAGTGCTAACGG + Intergenic
1179405200 21:41120234-41120256 ACAGGGAAAGCTGGAGCTGATGG - Intergenic
1179631299 21:42680232-42680254 ACTGAGAGATGTGGAGCTGGTGG - Intronic
1179953538 21:44725023-44725045 ACTGGCTCATTTGGAGCTTTTGG + Intergenic
1179953565 21:44725193-44725215 ACTGGCTCATTTGGAGCTTTTGG + Intergenic
1181545512 22:23599959-23599981 CCTGGGACATCAGGAGCTGAGGG + Intergenic
1181597255 22:23924152-23924174 AATGGGACATATGGAGATGGAGG + Intergenic
1181801204 22:25348964-25348986 CCTGGGACATCAGGAGCTGAGGG - Intergenic
1181814798 22:25429940-25429962 CCTGGGACATCAGGAGCTGAGGG - Intergenic
1185195636 22:49467666-49467688 ACTGGGACCCTTTGAGCTCAGGG - Intronic
950567913 3:13782180-13782202 AGTGTGAGATTTGGACCTGATGG + Intergenic
952561864 3:34604226-34604248 ACTGGGAGTTTAGGAGCTGCTGG + Intergenic
954289924 3:49644244-49644266 GCTGAGCCATTTGTAGCTGATGG + Intronic
954562310 3:51567975-51567997 ATGGGGACATTTGGATGTGAAGG + Intronic
957057848 3:75457946-75457968 ACTGGGACATGTGGAACTCCAGG + Intergenic
957527064 3:81391326-81391348 ATTGTGACATTTGTACCTGAAGG + Intergenic
959855639 3:111154118-111154140 ACTAGGACTTTTGGAAATGACGG - Intronic
959932215 3:111997335-111997357 GTTGGGACACTTGGAGCTTAGGG - Intergenic
961890308 3:130125406-130125428 ACTGGGACATGTGGAACTCCAGG + Intergenic
961919817 3:130414093-130414115 ACAGGCACATTGGGAGCTGAAGG + Exonic
962004940 3:131339316-131339338 AATTGAACATTTAGAGCTGAAGG + Intronic
963866533 3:150368053-150368075 ACAGGGCCATGTGGAACTGAGGG - Intergenic
965726705 3:171724811-171724833 AGTGGGAAATTTGAAGGTGATGG - Intronic
966386423 3:179403955-179403977 ACAGGGACATTTGGGGGTGGGGG - Intronic
967081626 3:186054888-186054910 AAAGGAACATTTGGAGCTTAGGG + Intronic
968594107 4:1473523-1473545 ACTTGGCCATATGGAGCTGCTGG - Intergenic
969001718 4:3987956-3987978 ACTGGGACATGTGGAACTCCAGG + Intergenic
969598673 4:8163087-8163109 ACTGGGACAGGTGGGGCTGTGGG + Intergenic
969752310 4:9120707-9120729 ACTGGGACATGTGGAACTCCAGG - Intergenic
969812198 4:9656858-9656880 ACTGGGACATGTGGAACTCCAGG - Intergenic
973007109 4:45022923-45022945 AATGGGAGATCTGGAGCGGAAGG + Intergenic
973773963 4:54229127-54229149 ACTGGGAGATTCGGAGCGCAGGG + Exonic
974433167 4:61824637-61824659 ACTGTTACATTTGGAGGTCAAGG - Intronic
974569890 4:63630884-63630906 ACTGGAACATTTGTAACAGAAGG + Intergenic
974810182 4:66935884-66935906 ACTGGGACTTTTGGAGGCGATGG + Intergenic
976430422 4:84957574-84957596 ACTGGGGAATTTGGAGTTAATGG + Intronic
977993121 4:103468898-103468920 ATTTGGACATATGGAGCTGGAGG - Intergenic
978112526 4:104979308-104979330 GCTGAGACATTTGGAGCTGCAGG - Intergenic
978902017 4:113962776-113962798 ACTGGGAAGCTTGGAGCAGAAGG - Intronic
979690575 4:123554479-123554501 ACTGGGTCAGTTGGAGGTCAGGG + Intergenic
979977457 4:127214323-127214345 GCTGGCAAATATGGAGCTGACGG - Intergenic
980266112 4:130518206-130518228 ACTGGAAAATATGGAGATGAAGG + Intergenic
980397921 4:132239546-132239568 CCTGAGACATTTGGAGTTTATGG - Intergenic
980442182 4:132863566-132863588 AGTGGTACATTTGTTGCTGAAGG - Intergenic
980975147 4:139604154-139604176 ACTGGGACCTTGGGAGCAGCTGG + Intronic
981066565 4:140492298-140492320 ACTGGGACATTTGGAGCTGAAGG - Intronic
981692884 4:147528892-147528914 ACTGGGGGGTTTGGAGCAGAGGG + Intronic
982110428 4:152048292-152048314 ACTGGGACTTTCGGTGCTGGAGG - Intergenic
989384875 5:40845275-40845297 ACAAGGACATTTGAAGGTGAAGG - Intronic
992186602 5:74250445-74250467 ACTAGGCCAGTTGGAGGTGATGG + Intergenic
992612916 5:78522916-78522938 AATGGGAGAGTTGTAGCTGAGGG + Intronic
994640238 5:102398522-102398544 ACTGTGAAAGATGGAGCTGAGGG - Intronic
996888955 5:128394457-128394479 ACTGAGACATTATAAGCTGAAGG + Intronic
998462868 5:142322517-142322539 AGGTGGACATTTGGAGCTTACGG - Intronic
999127650 5:149258284-149258306 CCTGGGACAGGTGGCGCTGAAGG - Exonic
999232588 5:150070341-150070363 ACTGGGAGATTGGGAGGTGGCGG - Intronic
999880989 5:155863688-155863710 CATGGGAGATTTGGAGATGAAGG + Intergenic
1001216023 5:169856434-169856456 TCTGAGATTTTTGGAGCTGAGGG + Intronic
1004538107 6:16522447-16522469 ACTGGGTCCTTTGGAGAGGATGG - Intronic
1006422342 6:33943013-33943035 ACTGGCACTTTGGGAGCTCAGGG + Intergenic
1008615540 6:53222196-53222218 AGTGGGACCTTGGGAGGTGATGG + Intergenic
1009530464 6:64806736-64806758 AAAGGGAAATTTGGAGCTGGAGG + Intronic
1011476513 6:87754098-87754120 AATGGGACATTTTCAGATGATGG - Intergenic
1012397875 6:98820881-98820903 AGGGGGAAATTTAGAGCTGAAGG - Intergenic
1012697753 6:102409997-102410019 TCTGTGAGATTTGGAGCTGATGG - Intergenic
1013215812 6:108026286-108026308 ACTTTTCCATTTGGAGCTGAAGG + Intergenic
1013920473 6:115396718-115396740 ACTGGGTGATTTGGACCAGAAGG - Intergenic
1017528327 6:155262512-155262534 ACTGGGAGAACTGGAGTTGAAGG - Intronic
1023577792 7:41648045-41648067 AGTGGTCCATTTGCAGCTGATGG + Intergenic
1024527647 7:50362341-50362363 CCAGGGGCATTTGGAGCTGAAGG + Intronic
1025035034 7:55588605-55588627 GCTGGGGCAGATGGAGCTGAGGG + Intergenic
1025197976 7:56946887-56946909 CCTGCCACATCTGGAGCTGAGGG + Intergenic
1025673971 7:63630048-63630070 CCTGCCACATCTGGAGCTGAGGG - Intergenic
1028615723 7:92764477-92764499 ACTGTGACACTTGGAGTTTAGGG - Intronic
1037300059 8:17442191-17442213 AAGGGGCCATGTGGAGCTGAGGG + Intergenic
1037303402 8:17478211-17478233 ACTGGGGAACTTGCAGCTGATGG + Intergenic
1037891540 8:22626475-22626497 CCTTGGCCATTTGGGGCTGAGGG - Intronic
1038189073 8:25302384-25302406 CGTGGGCCATATGGAGCTGAAGG + Exonic
1039370434 8:36978879-36978901 ACAGTGCCATTTGGAGCTGTTGG - Intergenic
1042036350 8:64538548-64538570 ACTGGAACATTTGGAGGAGGTGG + Intergenic
1042469323 8:69165443-69165465 TCTGGGGCAATTGGAGCAGATGG + Intergenic
1042575963 8:70219116-70219138 ACTGGGACATAGGGACCAGAGGG + Intronic
1043526517 8:81103571-81103593 ACTGGAGTATTTGGAGATGATGG - Intronic
1044533715 8:93336909-93336931 ACTGGCACGTTTGCAGCTAAGGG + Intergenic
1044743542 8:95351295-95351317 ACTGAGACCTTTGGGGTTGATGG + Intergenic
1046549484 8:115696459-115696481 TCCAGGACATGTGGAGCTGAGGG - Intronic
1047743269 8:127824347-127824369 CCTGGGACACATGGGGCTGAAGG - Intergenic
1047841277 8:128755468-128755490 GCTGAGCCATCTGGAGCTGATGG - Intergenic
1049661869 8:143823173-143823195 ACTGGGGCACCTGGTGCTGAGGG - Intronic
1049661881 8:143823224-143823246 ACTGGGGCACCTGGTGCTGAGGG - Intronic
1049661894 8:143823275-143823297 ACTGGGGCACCTGGTGCTGAGGG - Intronic
1050237146 9:3594005-3594027 ACTGGAACACTGGCAGCTGATGG + Intergenic
1052477615 9:28980632-28980654 ACAGGGCCATTTGGAGATGGCGG - Intergenic
1053474512 9:38372418-38372440 ACTGGGAAATTGGGAGGGGATGG + Intergenic
1053684344 9:40507364-40507386 ACTGGGACACATGCAGCAGAGGG + Intergenic
1054279381 9:63117589-63117611 ACTGGGACACATGCAGCAGAGGG - Intergenic
1054297438 9:63342828-63342850 ACTGGGACACATGCAGCAGAGGG + Intergenic
1054395456 9:64647336-64647358 ACTGGGACACATGCAGCAGAGGG + Intergenic
1054430102 9:65152536-65152558 ACTGGGACACATGCAGCAGAGGG + Intergenic
1054500281 9:65868996-65869018 ACTGGGACACATGCAGCAGAGGG - Intergenic
1057290302 9:93802090-93802112 GCTGGCACATGTGCAGCTGAGGG - Intergenic
1060362270 9:122970716-122970738 ACTGGGACTTTTGGAGTTTTGGG - Intronic
1061605616 9:131708432-131708454 AGTGGTACATTTGGAGCTCAAGG - Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1188019555 X:25142594-25142616 ACTGGGAGACTTGGAGTTGGGGG + Intergenic
1190112999 X:47607114-47607136 GTTGGGACATTTGGACCTGGGGG - Intronic
1190520282 X:51272291-51272313 AAGGGTAGATTTGGAGCTGAAGG - Intergenic
1192185851 X:68946378-68946400 TCTGGAAGAATTGGAGCTGAAGG + Intergenic
1192547565 X:72026623-72026645 AATGGGAAATATGGAGGTGAGGG + Intergenic
1193000181 X:76554802-76554824 ATGGGGACTTTTGGAGGTGATGG + Intergenic
1195615620 X:106909706-106909728 TTTGGGACATTTGGACTTGAGGG - Intronic
1197162941 X:123344494-123344516 TCTGGGACCTCTGGAGGTGATGG - Intronic
1198220685 X:134598906-134598928 TTTGGAATATTTGGAGCTGAAGG + Intronic
1201349873 Y:13028019-13028041 ACTGGGACAAATGCTGCTGATGG - Intergenic