ID: 981070833

View in Genome Browser
Species Human (GRCh38)
Location 4:140536320-140536342
Sequence CTATGTCAACATACCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981070833_981070836 30 Left 981070833 4:140536320-140536342 CCAGCGCTGGTATGTTGACATAG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG 0: 1
1: 1
2: 1
3: 23
4: 287
981070833_981070835 26 Left 981070833 4:140536320-140536342 CCAGCGCTGGTATGTTGACATAG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 981070835 4:140536369-140536391 CATTTTCTATGTGAATATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981070833 Original CRISPR CTATGTCAACATACCAGCGC TGG (reversed) Intronic
915635930 1:157186509-157186531 CTGTGTCAAAACACCAGCCCTGG - Intergenic
915662523 1:157415957-157415979 CTGTGTCAAAACACCAGCCCTGG - Intergenic
920136590 1:203774285-203774307 CTATGTCAACATGACAGGGTTGG + Exonic
1062962185 10:1580785-1580807 CTATGAAAACATACCAGTGGTGG - Intronic
1071887651 10:89968384-89968406 CTAATTCACCATACCAGCACAGG - Intergenic
1080255467 11:30285558-30285580 CTATGAGAACATGCCAGAGCTGG + Intergenic
1085638318 11:78174888-78174910 CTCTTTCAAAATACCAGGGCTGG - Intronic
1100408950 12:94295635-94295657 CTCTGTCAAAATCCCAACGCTGG + Intronic
1104485545 12:129148769-129148791 CTCTGTCACCTTACCAGCCCTGG - Intronic
1117536056 14:56704360-56704382 CTATGTCAACAAAGCAGCTGGGG + Intronic
1121172952 14:91869727-91869749 CTATGTAAACAAACCACAGCAGG - Intronic
1147636963 17:41969896-41969918 CAATGTCAACAAACCAGAGTGGG - Intronic
1148567492 17:48642241-48642263 CTATGTCCAGCCACCAGCGCAGG - Intergenic
1158255541 18:55544144-55544166 GTATGTCAAGATTCCAGCCCTGG + Intronic
1164736676 19:30546167-30546189 CTATGTAGACATCCCATCGCAGG - Intronic
929432421 2:41898297-41898319 CTATGTCATGATACCAGCCATGG - Intergenic
933985967 2:87592393-87592415 CTATGTGAAGATACCTGCTCTGG + Intergenic
934704364 2:96466377-96466399 CTATGTCTACAGAGCAGAGCTGG - Intergenic
936307870 2:111358411-111358433 CTATGTGAAGATACCTGCTCTGG - Intergenic
941538553 2:166753512-166753534 TAATGTCACCATACCAGCCCTGG - Intergenic
943540565 2:189208791-189208813 CTGTGTCAGCATACCAGAACAGG - Intergenic
943755443 2:191552236-191552258 CTTTGGCAACATACCAGCTTAGG - Intergenic
946445107 2:219732217-219732239 TTATATCAACATAACAGGGCAGG - Intergenic
947157414 2:227176309-227176331 ATATTTCCACATACCAGCGTCGG + Intronic
1178556841 21:33599512-33599534 CTGTGTCAACAGACCAGCCTTGG - Intronic
1180006660 21:45025717-45025739 GAATGTCAACACACCAGGGCTGG + Intergenic
1184461684 22:44641304-44641326 CTAGGCCAACAGACCAGCGGAGG + Intergenic
950287657 3:11757768-11757790 CCATGTCACCATACCAGTGCAGG + Intergenic
951815815 3:26753153-26753175 CTGTGTCAACATAGCAAAGCTGG - Intergenic
952806255 3:37355928-37355950 CTATTTCATCATACCAGCACTGG + Intronic
952964284 3:38611441-38611463 CTATGTCCACAGACCAGGTCAGG - Intronic
953519211 3:43625113-43625135 CTGTGTCACCATACCACTGCAGG + Intronic
957160643 3:76604987-76605009 CTATGTCAACTTGCCAAGGCTGG + Intronic
961546567 3:127638359-127638381 ATATGTCAAATTACCAGCACTGG + Intronic
981070833 4:140536320-140536342 CTATGTCAACATACCAGCGCTGG - Intronic
984701023 4:182818965-182818987 CTTTGTCAACAGAGCAGGGCTGG + Intergenic
1008761420 6:54856290-54856312 CTATGTCAGCATAACAGTGGGGG - Intronic
1024303422 7:47905352-47905374 CTATGTCAACATAGGAGGGCTGG + Intronic
1046395851 8:113638088-113638110 CTATATCACCATAACAGCACTGG - Intergenic
1049063227 8:140292591-140292613 CAATGTCAACATGCCAGCTCTGG - Intronic
1054837869 9:69699020-69699042 GTATGTTAACATACTAGCTCAGG - Intergenic
1198383029 X:136102152-136102174 CTATGTGAGCATAGCAGAGCAGG - Intergenic
1198655669 X:138910933-138910955 CTATGTCAGTATCCCAGTGCAGG + Intronic
1201125535 Y:10910615-10910637 ATATGTCACAATACCACCGCAGG + Intergenic