ID: 981070836

View in Genome Browser
Species Human (GRCh38)
Location 4:140536373-140536395
Sequence TTCTATGTGAATATAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981070833_981070836 30 Left 981070833 4:140536320-140536342 CCAGCGCTGGTATGTTGACATAG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG 0: 1
1: 1
2: 1
3: 23
4: 287
981070834_981070836 -8 Left 981070834 4:140536358-140536380 CCTTCATTCAGCATTTTCTATGT 0: 1
1: 0
2: 4
3: 58
4: 490
Right 981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG 0: 1
1: 1
2: 1
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981070836 Original CRISPR TTCTATGTGAATATAGAGGA AGG Intronic
900826716 1:4932909-4932931 TTCTATGTGGACTGAGAGGAAGG - Intergenic
901505856 1:9685250-9685272 TTCTATTAGAATAAACAGGAGGG - Intronic
903764493 1:25725397-25725419 TGCTACGGGAATACAGAGGAAGG + Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
910104451 1:83616404-83616426 GGCTTTGTGAGTATAGAGGAGGG - Intergenic
911009194 1:93261721-93261743 TAATATGTGAATATGGGGGATGG - Intronic
913141099 1:115942217-115942239 TCATATGTGAATCAAGAGGATGG + Intergenic
913484314 1:119319899-119319921 TGCTATGAAAATACAGAGGAAGG - Intergenic
916432135 1:164740830-164740852 TTCTATGGGAAGATAGAAAAGGG + Intronic
916795532 1:168163622-168163644 TGCTATGAGAATACAGAGAAAGG - Intergenic
918435779 1:184511402-184511424 TACTATGTGAAAATAGAGGTTGG + Intronic
919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG + Intergenic
919960024 1:202457684-202457706 TGCTATGAGAGCATAGAGGAGGG + Intronic
921412130 1:214846794-214846816 TTCTATGGCAATATTGAGAAGGG - Intergenic
921875371 1:220189550-220189572 TTCTATCTGAAAATAAAGAAAGG + Intronic
922627182 1:227060533-227060555 TTGTATGGGAACCTAGAGGAGGG + Intronic
922678413 1:227568467-227568489 TTCTTTGAGAACATAAAGGATGG + Intronic
923809852 1:237301753-237301775 TACCATGCGAATAAAGAGGAGGG - Intronic
1064202563 10:13297343-13297365 TTGTATGAGAATATTTAGGAAGG + Intronic
1064941060 10:20736009-20736031 ATATATGTGAATATAGATGGTGG - Intergenic
1065331126 10:24601009-24601031 TTATATGTAAATGCAGAGGAAGG - Intronic
1066120985 10:32287063-32287085 TTCTCTATGAACATTGAGGAGGG - Intronic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1068519128 10:58060089-58060111 TTTTAGGTGAATTTAAAGGAAGG - Intergenic
1068756067 10:60654813-60654835 CTCTTTGAGAAAATAGAGGAAGG - Intronic
1070078390 10:73160783-73160805 GGCTATGTGAGTATAAAGGAGGG + Intronic
1072233881 10:93436893-93436915 TTCCATGAAAATATAGAGCAAGG - Intronic
1073794452 10:106972734-106972756 TACTATGGGAATAAAGAGAAGGG + Intronic
1074551447 10:114446066-114446088 TTCTATTTGAAAATTGAGGCTGG - Intronic
1074727004 10:116321409-116321431 TGCTATGGGAATATAGGAGAGGG - Intergenic
1076089728 10:127672484-127672506 TTCTATGAGAAAATACAAGAGGG + Intergenic
1076169982 10:128311223-128311245 TTTCATGTGAAAATACAGGAAGG + Intergenic
1076742235 10:132492173-132492195 TTCTAAGTGAACACACAGGAAGG + Intergenic
1077862364 11:6194455-6194477 TGCTATGTGAATTCAGAGGGAGG + Intergenic
1078149489 11:8746570-8746592 TTCTGAGTGAATGCAGAGGAGGG + Intronic
1078422013 11:11220276-11220298 GACTATGAGAGTATAGAGGATGG + Intergenic
1079468724 11:20758000-20758022 TGCCATGTGAAGATAGAGCAAGG - Intronic
1080320738 11:31006354-31006376 CTCTATGGGAATCTATAGGAAGG - Intronic
1081822811 11:46016589-46016611 TGCTCTTTGAATATAGAGAAGGG - Intronic
1082934032 11:58638230-58638252 TTCTATGGGAAAATGAAGGAGGG - Intergenic
1084772990 11:71356593-71356615 CTCTATTTGAAGGTAGAGGAAGG - Intergenic
1085438568 11:76534816-76534838 TATAATCTGAATATAGAGGAAGG + Intronic
1085553269 11:77395207-77395229 TGCTTTGGGAATATGGAGGAGGG - Intronic
1085560408 11:77467275-77467297 TGCCATGTGAACACAGAGGAAGG - Intronic
1085724127 11:78939614-78939636 TGCTATGGGAACATAGAGAATGG - Intronic
1085896238 11:80642822-80642844 TAATGTGTGAATATAGGGGAGGG - Intergenic
1086153732 11:83642373-83642395 TTCTATCTGAAAACAGAGAAGGG - Intronic
1087177154 11:95106409-95106431 TTCTGGTTGAATATAAAGGAAGG + Intronic
1087571663 11:99935044-99935066 TTCTATGTGAAGATATATGCTGG - Intronic
1087607907 11:100399450-100399472 TGCTAAGTCAATAAAGAGGATGG + Intergenic
1087890975 11:103537603-103537625 TGCTATGTTAATAGAGAGAAAGG + Intergenic
1088564382 11:111152469-111152491 TGCTATGGGACTCTAGAGGAGGG + Intergenic
1096202966 12:49698992-49699014 TTTTCTTTGAAGATAGAGGAGGG - Intronic
1097481296 12:60129044-60129066 TTCTTTGTGGATATAAAGAAAGG + Intergenic
1097736312 12:63185261-63185283 TTCTATGATAATGGAGAGGAAGG - Intergenic
1098451480 12:70622935-70622957 TTCTATGAGAATTTAGGGGGGGG + Intronic
1099068718 12:78017996-78018018 TTCCATGTGAATATAAAGCAAGG + Intronic
1101419169 12:104535207-104535229 CTCTATGAGAATATCAAGGACGG - Intronic
1101655847 12:106719556-106719578 TGCTATGTGAGTGCAGAGGAGGG + Intronic
1103142329 12:118559588-118559610 TTTTATGGGAGTATAGAAGAGGG + Intergenic
1103642082 12:122359660-122359682 TTCTACCTGAACATAGAGGAAGG + Intronic
1103732377 12:123036509-123036531 TTCTTTTTTAATAGAGAGGAGGG - Intronic
1103791580 12:123475875-123475897 TTTTAAGTGAATTTAGAGGCAGG - Intronic
1106769204 13:32945327-32945349 TTCTATGGGAAGATAGACTAGGG + Intergenic
1107598697 13:41990701-41990723 TTTTATGGAAATAAAGAGGAGGG - Intergenic
1108195407 13:47989665-47989687 TTACATGTGAATAGAGAGGGAGG - Intronic
1109650274 13:65314507-65314529 TTCTATGTGACTTTAGTTGATGG - Intergenic
1109690064 13:65875384-65875406 TTCTATATTCATATAGATGAAGG + Intergenic
1109737534 13:66506101-66506123 GACTATGTGATTCTAGAGGAAGG + Intronic
1111275835 13:85945830-85945852 TTCTATGTGAATATTCAATAGGG - Intergenic
1111965318 13:94856257-94856279 CTCTATGTGGACAGAGAGGAGGG + Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112182390 13:97096715-97096737 TTCCAGGTGAAGAGAGAGGAAGG + Intergenic
1113455064 13:110442594-110442616 TTCTGTGTTTATGTAGAGGAGGG - Intronic
1114445558 14:22785368-22785390 TTCTGTGTGGAGACAGAGGAGGG - Intronic
1114628282 14:24143568-24143590 TTCTATGTGAGTGTGGAGTAAGG - Exonic
1114637778 14:24197894-24197916 TTCTATTTGAATACAGAATAGGG - Intronic
1115013303 14:28577325-28577347 GTGTATCTGAGTATAGAGGAAGG - Intergenic
1115079028 14:29428233-29428255 TACTCTGTGAGTACAGAGGAGGG + Intergenic
1116607416 14:47018917-47018939 TGCCATGTGAACACAGAGGACGG - Intronic
1116671876 14:47852590-47852612 ATCTTTGTGAATATAAAGCAGGG - Intergenic
1117339005 14:54777974-54777996 TTCTGCGTGAAAACAGAGGATGG - Intronic
1117773837 14:59162118-59162140 TTCTAAGTAAAGAAAGAGGAAGG + Intergenic
1119460183 14:74795601-74795623 TGATATGAGAATGTAGAGGAGGG - Intronic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1121812205 14:96901104-96901126 TGCTATGGGGATTTAGAGGAAGG - Intronic
1121982347 14:98465920-98465942 TTCTTTGTGAAGAGAAAGGAAGG + Intergenic
1124711224 15:32014007-32014029 ATCTATGTGATTAGAGAAGAGGG - Intergenic
1124803243 15:32855868-32855890 TGCTATGTGACTATAGGAGATGG - Intronic
1125133919 15:36318459-36318481 TTCTTTCAGAAGATAGAGGAAGG - Intergenic
1126158355 15:45586093-45586115 TTGGCTTTGAATATAGAGGAAGG - Intergenic
1126834455 15:52645503-52645525 TGCTATGGGAATATTTAGGAGGG + Intronic
1129022932 15:72539817-72539839 CTCTATATGAATATTGAGGAGGG + Intronic
1133549721 16:6842439-6842461 TTGTATATAAATATAGAGCAAGG - Intronic
1135854994 16:26001332-26001354 GTCTATGTGAATATACATAAAGG + Intronic
1135939489 16:26809200-26809222 TTCTCTCTGAAAATAAAGGATGG + Intergenic
1137882175 16:52061375-52061397 TTCTATGTGCACATAGAGAATGG + Intronic
1138118600 16:54380095-54380117 ATCTGTGTGATTAGAGAGGAGGG + Intergenic
1141460359 16:84175337-84175359 GTCTGTCTGAATATAGGGGAAGG + Intronic
1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG + Exonic
1142933329 17:3307137-3307159 TGCTATGGGAAGACAGAGGAAGG + Intergenic
1143191786 17:5045241-5045263 TTCTATGGGAGTTCAGAGGAGGG - Intronic
1143690403 17:8558342-8558364 TGCTATGGGAACATAGAGAAAGG + Intronic
1146222067 17:31032806-31032828 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1148561157 17:48607258-48607280 TTCTGTGTGTATCTAAAGGATGG - Exonic
1148627581 17:49081537-49081559 GACTTTGTGAATATCGAGGAAGG - Intergenic
1150792129 17:68207250-68207272 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1150832067 17:68531568-68531590 TTCTAGCTGAATAAAAAGGAAGG - Exonic
1151135359 17:71941439-71941461 TTCTTTGTGTAGATAGAGAAAGG + Intergenic
1151381793 17:73730786-73730808 TTCTATGGGAATGCACAGGATGG - Intergenic
1151428171 17:74044760-74044782 TGCTCTGTGAATATTAAGGAAGG + Intergenic
1153112816 18:1613013-1613035 TTTTATGTGAATATATAAGGTGG + Intergenic
1155192206 18:23439990-23440012 TGATATGTGAATACGGAGGAAGG - Intergenic
1155334125 18:24747824-24747846 TTCTATGGGACTTGAGAGGAAGG - Intergenic
1155626248 18:27838267-27838289 TTTTGTTTGAATTTAGAGGAGGG + Intergenic
1155924038 18:31634664-31634686 TTCTAGTTAAATATAGAGGATGG - Intronic
1157950456 18:52030853-52030875 TACTATGGGAATATAGGGAAAGG + Intergenic
1158147324 18:54330030-54330052 TTCTATGTGAATGCAGAGGGGGG + Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158795007 18:60835117-60835139 TTGTATGTAAATATAGTGCAAGG + Intergenic
1158917515 18:62150396-62150418 TATTAAGGGAATATAGAGGAGGG + Intronic
1159416833 18:68162022-68162044 ATATATGTAAATAAAGAGGAAGG + Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160431418 18:78815597-78815619 TTCTAGCTGAACAGAGAGGAAGG + Intergenic
1163704643 19:18805015-18805037 TTTTATGTAAATATGAAGGAAGG - Intergenic
1166990496 19:46689909-46689931 TTCTATTTAAATATAGAGATGGG + Intronic
927004842 2:18837216-18837238 GTCTATGAGAACAGAGAGGAAGG - Intergenic
927624888 2:24705112-24705134 TTCAATATGAATCTATAGGAGGG - Exonic
929061528 2:37929959-37929981 TATTATGTGAATATTGAGGAAGG + Intronic
931794240 2:65694069-65694091 TTGTGTGTCAAAATAGAGGAGGG + Intergenic
932609963 2:73191579-73191601 TTCTATGGGAGTACAAAGGATGG - Intergenic
933400247 2:81787221-81787243 CTCTATGTTAAGATAGAGAAAGG - Intergenic
935109754 2:100081591-100081613 TTGTCTGTGAATATAGAACATGG - Intronic
936125220 2:109783618-109783640 TTGTCTGTGAATATAGAACATGG + Intergenic
936219473 2:110587850-110587872 TTGTCTGTGAATATAGAACATGG - Intergenic
937535593 2:122882935-122882957 TTCTATGTGTGTGTGGAGGAGGG - Intergenic
940176741 2:150885953-150885975 TACAATGTGAATCTAGAAGATGG + Intergenic
941013395 2:160326894-160326916 GTCTCTGTGAATTTAGAAGATGG + Intronic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
944323425 2:198375910-198375932 TTCTATGTCAATCAAGATGAGGG - Intronic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
945664402 2:212722719-212722741 TTCTATGAAAATATAGACAAGGG + Intergenic
945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG + Intronic
946101368 2:217327506-217327528 TACTATGGGAACATAGAAGAGGG + Intronic
946577166 2:221088261-221088283 TTCTCTGTGAATAAAGAGAGAGG + Intergenic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1169700534 20:8441722-8441744 TCCTATGGGCAGATAGAGGAGGG + Intronic
1170331902 20:15221685-15221707 TTCTTTTTTAATATAGAGGATGG + Intronic
1174729348 20:52899778-52899800 TTCTATGTACATATACACGAGGG - Intergenic
1174741177 20:53015642-53015664 TTCTATGTTAAAATATAGGAGGG + Intronic
1175567111 20:59989081-59989103 TTCATTGTCAATAAAGAGGAGGG + Exonic
1175572393 20:60033952-60033974 TTCTATGAGAATTTATAGAAGGG - Intronic
1176206341 20:63890655-63890677 TTTTATATGTATATAGATGAGGG + Exonic
1176697528 21:9997807-9997829 TTCTAGCTGTTTATAGAGGATGG + Intergenic
1177858377 21:26424765-26424787 GTCACTGTGATTATAGAGGAAGG + Intergenic
1177864153 21:26492883-26492905 TTCTATGAGATCAGAGAGGACGG + Intronic
1178229211 21:30761790-30761812 TTCCATGGGAATATAGATGATGG - Intergenic
1179095840 21:38313902-38313924 GCCTATGTGATTCTAGAGGAAGG + Intergenic
1179155767 21:38849773-38849795 TTCACTGTGAAGACAGAGGAAGG + Intergenic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1181959743 22:26614428-26614450 ATCTATGTGAATATCGGGGCAGG + Intronic
1182711197 22:32324517-32324539 TTCTAGGTGGAGATAGGGGAGGG - Intergenic
1184398723 22:44261320-44261342 TTCTAGGTGGAGATAGGGGAGGG - Intronic
1184580003 22:45410385-45410407 TGCTTTGTGGATATAGGGGAAGG - Intronic
949432161 3:3989413-3989435 TGCTATGGGAACATAGAAGAGGG + Intronic
951823302 3:26838396-26838418 ATCTATGTGACGAGAGAGGAGGG + Intergenic
952664714 3:35890328-35890350 TTCTATGAGGATATAGGGGCAGG - Intergenic
953396084 3:42571466-42571488 GTGTATGTGAATGTACAGGATGG + Intronic
954471404 3:50699087-50699109 TTCTATGTGATAGTAGAGAAGGG + Intronic
955086115 3:55704631-55704653 TGCTATGTGAGTCTAGTGGATGG - Intronic
955851383 3:63223735-63223757 TGCTATGGGAATATAGAAGAGGG - Intergenic
955882307 3:63560528-63560550 ATCTTTGTGAATAAAGAGGATGG - Intronic
956321082 3:67996963-67996985 ATCTATGGGAGTGTAGAGGAGGG + Intergenic
957442733 3:80271458-80271480 ATGTATGTGCATATAGAGGCAGG + Intergenic
958025457 3:88043518-88043540 TTCTATTTGTTTATATAGGATGG - Intergenic
958068358 3:88575430-88575452 TTTTATGTGTATATAGAGTAGGG + Intergenic
958105522 3:89067745-89067767 TTCTCTGTCACTAAAGAGGATGG + Intergenic
958724106 3:97882515-97882537 TTCTGTGGTAGTATAGAGGAGGG + Intronic
959469274 3:106729600-106729622 TTTTCTTTGAATATTGAGGAAGG - Intergenic
959757853 3:109920591-109920613 TTCAATATTAATATAGATGAAGG + Intergenic
959803419 3:110523180-110523202 TTCTTTGTGAATACAAAGGCTGG + Intergenic
960998439 3:123354630-123354652 ATCTGTGTGAAAAGAGAGGAAGG + Intronic
963055647 3:141184445-141184467 TGCTATGTGATTTTAGAGGTTGG - Intergenic
964194819 3:154050834-154050856 TTCTGTGTGAAAATCCAGGATGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965167527 3:165214774-165214796 TTCTATGGAAATACAGAGAAGGG - Intergenic
965961662 3:174436460-174436482 CTCTATGTTAAAATAGAGCAAGG + Intergenic
966601341 3:181778278-181778300 TGCTATGGGAACATAGAGGAAGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967463714 3:189777653-189777675 TTCTATGGGAACAGAGAGAAAGG - Intronic
968034010 3:195530007-195530029 GTATATGTGAAAATAGAGGTTGG - Intronic
970421005 4:15905784-15905806 TTCGATGTGAAGACAGTGGAAGG - Intergenic
970427614 4:15959926-15959948 TTCCATGTGAAGACAGAGGCAGG + Intergenic
971442615 4:26704716-26704738 TTCTATGCAAATATAGATAAAGG + Intronic
971443952 4:26721978-26722000 TACTATGGGAGTCTAGAGGAAGG - Intronic
971667478 4:29508391-29508413 TTTTATGTGAGTATAATGGATGG - Intergenic
972650029 4:41007938-41007960 TTCTTTGGGAATACAGAGAAAGG + Intronic
972706857 4:41553326-41553348 TGCTGTGGGAACATAGAGGAGGG + Intronic
973934399 4:55828409-55828431 TGCTATGGGAATCAAGAGGATGG - Intergenic
978047932 4:104155704-104155726 TTCTATGTGGGTATAGATAAAGG + Intergenic
979157768 4:117419474-117419496 ATCTAAGTGAACAAAGAGGACGG + Intergenic
979810209 4:125027318-125027340 ATCTATATGAATATACATGAAGG - Intergenic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
980370073 4:131857681-131857703 TTCTAGCTGCTTATAGAGGATGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982976053 4:162062570-162062592 TTCTATATGGATATAAAGTAAGG - Intronic
983159929 4:164399871-164399893 TGCTATAGGAATCTAGAGGAGGG - Intergenic
983276615 4:165625325-165625347 TTCAATGTCAACATAGAGCAAGG - Intergenic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
987181332 5:15371740-15371762 TGCTATGGGAATTTAAAGGAGGG - Intergenic
987966579 5:24884889-24884911 TTCTATCTGAATACAGTAGAGGG + Intergenic
989220587 5:38957577-38957599 TGATTTGTGAATTTAGAGGATGG - Intronic
989430563 5:41350217-41350239 TTCAATGAGAAAACAGAGGACGG - Intronic
989663923 5:43829787-43829809 TTCTCAGTGGATATATAGGAAGG + Intergenic
990445598 5:55890973-55890995 TTCTATTTCAATATAGAAAAGGG - Intronic
992239820 5:74756176-74756198 TTCTATGCCAATTTTGAGGAGGG - Intronic
992414266 5:76537967-76537989 TTGTATTTGAGTGTAGAGGAGGG + Intronic
992516045 5:77492953-77492975 TTCTATGTTAATATAGCATACGG - Intronic
992549595 5:77848079-77848101 CTCTAAGTGAATAGAGATGAAGG - Intronic
993679951 5:90864523-90864545 TACTCTGTGAAAATAGATGAAGG + Intronic
994176812 5:96719964-96719986 TTCCATGAGAATGTAGATGAGGG - Intronic
994623129 5:102186973-102186995 TTCTATCTTGATATATAGGAAGG - Intergenic
995262032 5:110115442-110115464 GTCTATCTAAATATAGAGAAGGG - Intergenic
996600478 5:125257014-125257036 TTCTATGTGAATTTAAGGGTGGG + Intergenic
996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG + Exonic
996949597 5:129109824-129109846 TTCTACAGGAATAGAGAGGAAGG - Intronic
998316987 5:141191796-141191818 TTTTATGAGAGAATAGAGGAGGG + Intronic
998614135 5:143720788-143720810 TTCTAGGTGAATAAAGAGAGTGG + Intergenic
1000927596 5:167212840-167212862 TCCTATGTGCATATGGAGTAGGG - Intergenic
1000936483 5:167308050-167308072 TCCTGTGTGAATAGAGAGAAAGG + Intronic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1002846314 6:948281-948303 TTCTATGGGAATAGAAAGTATGG + Intergenic
1003626130 6:7743172-7743194 ATATATGTAGATATAGAGGAAGG + Intronic
1004327293 6:14686820-14686842 TTCTAAGTGGATAAAGAGCAGGG + Intergenic
1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG + Intronic
1004704343 6:18109869-18109891 TTCTATCAGAAAATAAAGGAGGG + Intergenic
1010139923 6:72602323-72602345 TTCTATGTGAGAAAAGTGGAGGG - Intergenic
1013944048 6:115701817-115701839 GTATATGTGGATATAGAGGGTGG - Intergenic
1014610282 6:123535131-123535153 TTCTATTTGAATTTTGAGAAGGG + Intronic
1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG + Intronic
1018337905 6:162815364-162815386 TTCAATGTGTCTATACAGGAAGG - Intronic
1019281384 7:202176-202198 TCCCATGTGCATAGAGAGGACGG + Intronic
1019281435 7:202393-202415 TCCTGTGTGCATAGAGAGGACGG + Intronic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1022009558 7:26297068-26297090 ATATATGTAAATATAGAAGATGG + Intronic
1022584734 7:31596765-31596787 TTATATTGGAATATAGAGAATGG + Intronic
1022796939 7:33739392-33739414 TTTGATGTGAAAATAGAGGGAGG + Intergenic
1022891814 7:34708835-34708857 TCCTATGTGAATATCAGGGAGGG - Intronic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1023772137 7:43567554-43567576 TTAGATGTGTTTATAGAGGATGG + Intergenic
1024149685 7:46558354-46558376 GTATTTGTGAATATAGAAGAAGG + Intergenic
1028412026 7:90540239-90540261 TTCTATGGTAATAGAAAGGAAGG - Intronic
1030294177 7:107903891-107903913 TACTATGGGGAGATAGAGGAAGG + Intronic
1031506445 7:122590582-122590604 TTATATATGAATATATATGAAGG - Intronic
1031698000 7:124884686-124884708 TAATATTTGAATTTAGAGGAAGG - Intronic
1031829061 7:126603618-126603640 TTCTAACAGAATATAGAGAAAGG + Intronic
1032060640 7:128722142-128722164 TTCTTTCAGAAAATAGAGGAGGG - Intronic
1032287566 7:130552971-130552993 TGCTATGTGAATACACAGAAAGG + Intronic
1033896856 7:146082418-146082440 TGCTATGTGAAGATACAGCAGGG + Intergenic
1035147638 7:156835865-156835887 TTCTAAGTGAAATTAGAGGTTGG - Intronic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1038899448 8:31826047-31826069 TTCTAGGTGAAAATAGACTATGG - Intronic
1039759295 8:40557613-40557635 TGCTATGGGAATATAAAAGAGGG - Intronic
1040068493 8:43169328-43169350 TTTTATGTTTATATTGAGGAAGG + Intronic
1041081729 8:54221004-54221026 TTTTATGTGAATATAAAGATAGG - Intergenic
1042870636 8:73395374-73395396 TTTGATGTGAATATAAATGAAGG + Intergenic
1044361480 8:91289857-91289879 TTCTTTGGTAATATAGAGGTAGG - Intronic
1045060418 8:98406057-98406079 TACAATGGGAACATAGAGGAGGG - Intronic
1045154214 8:99449000-99449022 TTCTTAGTAAGTATAGAGGATGG + Intronic
1045901530 8:107287132-107287154 CTCAATGTGAATAAAGAGGCTGG + Intronic
1046155416 8:110283544-110283566 TTCTATATGAATTTCCAGGAGGG - Intergenic
1046424373 8:114027416-114027438 TTCTATATGAACATAGAACAAGG - Intergenic
1046508002 8:115161011-115161033 TTCAGTGTGAACATAGAGAAAGG - Intergenic
1046800412 8:118420291-118420313 TTGTGTGTGTATATATAGGAGGG + Intronic
1047201672 8:122772586-122772608 TTCTATGTGATTTTTGAGGCTGG - Intergenic
1047503293 8:125458909-125458931 TTCTGTGGGAACACAGAGGAGGG + Intergenic
1047521351 8:125597588-125597610 TTCTATATGAAGATATAGGCTGG + Intergenic
1047819139 8:128499429-128499451 TGTTATGAGAATACAGAGGAGGG - Intergenic
1048458309 8:134598364-134598386 TTCAATGTGAACATGTAGGATGG - Intronic
1048614928 8:136063524-136063546 TTCTTTGTGACTATAGAAAATGG - Intergenic
1050820138 9:9868549-9868571 TTCTATGTGAATAAAAAGTAGGG + Intronic
1051560429 9:18435489-18435511 TACTATGAGAATATATAGGAGGG + Intergenic
1051969328 9:22867824-22867846 TACTATGAGAATATAGACAATGG + Intergenic
1052383448 9:27796944-27796966 TTCTACGTGAATAGAGATGGGGG + Intergenic
1052944715 9:34159033-34159055 TTCCAAGTGAACATATAGGAAGG - Intergenic
1053103091 9:35387989-35388011 TTCAATCTGAATTTTGAGGAAGG + Intronic
1053634646 9:39984169-39984191 TTCTAGCTGCTTATAGAGGATGG + Intergenic
1053771282 9:41480164-41480186 TTCTAGCTGCTTATAGAGGATGG - Intergenic
1054209241 9:62266528-62266550 TTCTAGCTGCTTATAGAGGATGG - Intergenic
1054315575 9:63581602-63581624 TTCTAGCTGCTTATAGAGGATGG + Intergenic
1054700147 9:68405191-68405213 TTCTCTGGGACTATAGAAGATGG + Intronic
1055946506 9:81695960-81695982 TGTTATGTGAATATGTAGGAAGG - Intergenic
1056342219 9:85647717-85647739 TTCTATGTGAATGTAATGGTGGG + Intronic
1057205983 9:93173037-93173059 CTCCATGTGAATATAGAAGAGGG - Intergenic
1058591929 9:106574654-106574676 TTCTATGTGAATTTATTTGAAGG - Intergenic
1058633117 9:107009596-107009618 TTCCATGTGAATTTTGTGGACGG + Exonic
1059029245 9:110672437-110672459 TGCTATGTGAACATAGGGTAGGG + Intronic
1059601877 9:115787620-115787642 TTCTTTGTGACTCTAGAGAATGG + Intergenic
1186909554 X:14147633-14147655 TGTTATGAGAATATAGAGGATGG - Intergenic
1187239602 X:17500621-17500643 TTCTATGTGAAGCTAGGGAAAGG + Intronic
1187720959 X:22150365-22150387 TACTTTGAGAATATAGAGCAGGG + Intronic
1190516998 X:51234167-51234189 TTGGCTTTGAATATAGAGGAAGG + Intergenic
1190690847 X:52911819-52911841 TTCTTTTAGACTATAGAGGAGGG + Intergenic
1190695136 X:52943973-52943995 TTCTTTTAGACTATAGAGGAGGG - Intronic
1191108615 X:56788242-56788264 TCCCATGTGAATAAAGAGGAAGG - Intergenic
1191604687 X:63048060-63048082 TTCAATGTGAATAAAAAAGAAGG - Intergenic
1191826405 X:65370072-65370094 TTCTTTTTCAATATAGACGAGGG - Intronic
1194600553 X:95915625-95915647 TGCTATGTGAATTTGGGGGAAGG - Intergenic
1195762136 X:108257947-108257969 TTCTATATGAAAATAGGGAAGGG + Intronic
1197528437 X:127592148-127592170 TTTTATGGGAATTCAGAGGAGGG - Intergenic
1198890304 X:141387351-141387373 TTCTATAGGAAGGTAGAGGAAGG - Intergenic
1199688276 X:150284114-150284136 TTCCATGTGAAGATACAGCAAGG - Intergenic
1202575661 Y:26321972-26321994 TGCTATGAGAGTGTAGAGGAGGG - Intergenic