ID: 981070891

View in Genome Browser
Species Human (GRCh38)
Location 4:140536945-140536967
Sequence GTTGTAGCTTGGGGAACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981070891 Original CRISPR GTTGTAGCTTGGGGAACTAA TGG Intronic
901102625 1:6730928-6730950 GTTGTAGGTAGGAGAATTAAGGG - Intergenic
906249070 1:44297343-44297365 GTTGAAGGCTGGGGAACTCAAGG - Intronic
908609676 1:65843389-65843411 GCTGTACCTTGGGGAAGGAAAGG - Intronic
908742986 1:67347928-67347950 GTTGAAGCTTGGGGACATTAAGG - Intronic
913091189 1:115477703-115477725 GATGTAGCTTGGGGAATGAGAGG + Intergenic
915975012 1:160379675-160379697 GTTTTATCCTGGGGAAATAATGG - Intergenic
920218118 1:204375883-204375905 GTAGAGGCTTGGGGAAATAAAGG - Intronic
920352648 1:205347761-205347783 GTGGGAGGTTGGGGAATTAAGGG + Intronic
921959817 1:221022856-221022878 CATGTAGCTTGGGGAAATGAAGG + Intergenic
922082613 1:222311567-222311589 GCTTCAGCTTGGGGAATTAAGGG + Intergenic
922209213 1:223474699-223474721 GTTCTAGCTTGGAGAATTTATGG + Intergenic
922302372 1:224312957-224312979 ATTCTAGCCTGGGCAACTAAGGG + Intronic
923254523 1:232210059-232210081 GAAGTAGCTTTGGGAACAAATGG - Intergenic
923302417 1:232653809-232653831 GGTGGAGCTTGGGGACCTCATGG - Intergenic
1062810554 10:460227-460249 GTTGTTGGTTGGGGAAAAAAAGG + Intronic
1067424691 10:46197554-46197576 GATGTCACTTGTGGAACTAAAGG - Intergenic
1068490872 10:57722010-57722032 GTTGGGGCATGGGGGACTAAGGG + Intergenic
1077817025 11:5695842-5695864 GTTTTGGGTTGGGGAACAAAAGG + Intronic
1090132950 11:124164162-124164184 GGTGTTGCTGGGGGAACTTATGG - Intergenic
1095704616 12:45223134-45223156 GTAGTGGCTTGGGGAACTCAGGG - Intronic
1096793777 12:54061359-54061381 GTTTTAGCTGGAGGAACCAAAGG + Intergenic
1097196967 12:57248157-57248179 GCTGTAGAGTGGGGAACTATAGG + Exonic
1101722302 12:107360542-107360564 GTTGGAGCTTGGGGCACTTGTGG - Intronic
1102307634 12:111817843-111817865 ATTGTGGATTGGGGACCTAAAGG - Intergenic
1103538656 12:121651269-121651291 GGTTTAGCTTGGGGGAGTAAGGG - Exonic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1105685365 13:22775796-22775818 GTTGTAGCTTGAGAAACTACAGG + Intergenic
1106497336 13:30292380-30292402 ATTGGGGCTTGGGGAACTGATGG - Intronic
1109911781 13:68921919-68921941 GTTCTGTCTTGGGGAACTAGAGG + Intergenic
1110046646 13:70841207-70841229 GCTGTTGCTTGGGGATCAAAAGG + Intergenic
1112721673 13:102252814-102252836 GTTGTGGGGTGGGGAGCTAAGGG - Intronic
1115000970 14:28419312-28419334 ATTGTGGGTTGGGGACCTAAAGG + Intergenic
1115199614 14:30839059-30839081 ATTTTAGCTTGGGCAACAAAAGG + Intergenic
1118584122 14:67335912-67335934 GTTGTAGCTGGAGGATCCAATGG - Intronic
1123572863 15:21632667-21632689 TCAGTAGCTTGGGGAGCTAAGGG - Intergenic
1123609483 15:22075254-22075276 TCAGTAGCTTGGGGAGCTAAGGG - Intergenic
1124405117 15:29385066-29385088 GTGGTAGTTTGGGGATCTGATGG - Intronic
1129885188 15:79032379-79032401 GGTGTAGCTGGGGGAGCCAAGGG - Intronic
1202981726 15_KI270727v1_random:367039-367061 TCAGTAGCTTGGGGAGCTAAGGG - Intergenic
1137640385 16:50023876-50023898 GTTATGGCTTGTGGAACAAAGGG + Intergenic
1139382743 16:66543884-66543906 TTTGTAGTTTGGGGCTCTAAAGG - Intronic
1142357465 16:89608855-89608877 GTTGTAGCATGGGGCACACAGGG + Intergenic
1142786617 17:2229221-2229243 GTTGTTGTTTGGGCAACTCAGGG - Intronic
1143743939 17:8975875-8975897 CTTGTACCTTGGGGAACACAAGG + Intergenic
1148210400 17:45805141-45805163 GTTGGAGCTTGGGGCAAAAAGGG - Intronic
1150562804 17:66309366-66309388 GTTGTATCTTGGGGAAGGGAAGG + Intronic
1153060879 18:994044-994066 GGTGTGGCTTGGGGAAGTATGGG + Intergenic
1157265552 18:46217178-46217200 TTTAAAACTTGGGGAACTAATGG - Intronic
1161492611 19:4570509-4570531 GTTGTGGCTGGGGGAACCCAGGG - Intergenic
1162246335 19:9404947-9404969 GTGGTAGCTAGTGGAAGTAAGGG - Intergenic
1162258109 19:9509711-9509733 ATTGTGACTTGGGGACCTAAAGG - Intergenic
1162622502 19:11855234-11855256 ATTGTGGATTGGGGACCTAAAGG - Intronic
1164291128 19:23869530-23869552 ATTGTGGATTGGGGAACTAAAGG + Intergenic
1164979211 19:32600747-32600769 GTTGTGGCTGGGGGAGTTAAGGG - Intronic
925686419 2:6478458-6478480 GTTGTAGCTCAGGGAGTTAAGGG + Intergenic
935393473 2:102580149-102580171 ATAGTAGCTTTGGGAACAAAAGG - Intergenic
940130383 2:150374748-150374770 TTTGTAGAAAGGGGAACTAATGG + Intergenic
943407687 2:187510253-187510275 GTTGTAGAGTGCGTAACTAAGGG - Intronic
943808010 2:192147830-192147852 TTTGTACCTTGGGGATATAAGGG - Intronic
944707524 2:202306170-202306192 GTTTTAGTTTGGAGAACTATAGG - Intergenic
1170502270 20:16987016-16987038 GTTCTAGTTTGGGGAACCAGAGG + Intergenic
1170889192 20:20364662-20364684 GTTGTGGCTCGGGGGACTGAGGG + Intergenic
1170987837 20:21274587-21274609 GGTGTAGCATGGGGAACCACTGG + Intergenic
1172794781 20:37529099-37529121 GTGGTAGCTTGGGGAGGTGAAGG + Intergenic
1177018270 21:15817996-15818018 AGTGTAGCTTGGGGAACCAAGGG - Intronic
1179841158 21:44074804-44074826 GGCGTAGCCTGGGGAACTCAGGG + Intronic
1182756117 22:32681098-32681120 GATGTAGCTTGGTGAAGTGAGGG + Intronic
1182756239 22:32682024-32682046 GATGTAGCTTGGTGAAGTGAGGG + Intronic
949245589 3:1922737-1922759 GTTGCAGCTTGGGGAGTTAAAGG + Intergenic
949265262 3:2149784-2149806 GTTGTAGGTTGTGCAACTACAGG + Intronic
949691719 3:6648141-6648163 TTTGTAGCTTTGGGAAGAAAAGG + Intergenic
953171256 3:40509843-40509865 GTAGTAGCTTAGGGAATTATAGG + Intronic
953913220 3:46903254-46903276 CTTGTACCTTGGGGCAGTAAGGG - Exonic
964628545 3:158783417-158783439 CTTGTTGCTTGGGGAGTTAAGGG - Intronic
967101877 3:186222327-186222349 ATTGTAGTTTGGGTACCTAATGG - Intronic
971751733 4:30658359-30658381 GATGTAGCTTTAGAAACTAAAGG + Intergenic
972627908 4:40819065-40819087 GGTGGAGCTTGGGGAAGGAAAGG - Intronic
974268413 4:59617009-59617031 TTTGTAGCTTGGAGAAGTAGAGG + Intergenic
978007449 4:103634848-103634870 GTTGAAGCTAGAGAAACTAAAGG - Intronic
981070891 4:140536945-140536967 GTTGTAGCTTGGGGAACTAATGG + Intronic
981121318 4:141054045-141054067 GTGTTAGCTTTGGGAATTAAAGG - Intronic
984764800 4:183391913-183391935 GGTGTAGCCTGGAGAAGTAACGG - Intergenic
985136572 4:186792005-186792027 GTTGGAGAGTGGGGAACTAGGGG - Intergenic
989209440 5:38845375-38845397 GTCGTAGCATTGGGAAATAAAGG + Intergenic
989530079 5:42497879-42497901 CTTGTAGGTTGGGGAAGGAATGG + Intronic
991669116 5:69029706-69029728 TTTGTGGCTTAGGGAACAAATGG - Intergenic
991912622 5:71576638-71576660 ATTGTGGATTGGGGACCTAAAGG + Intergenic
995896336 5:117015518-117015540 GCTGTAGGTTGGGGCACTGAAGG + Intergenic
1001037199 5:168305697-168305719 TTTGGAGCTGGGGGAACAAAAGG + Intronic
1001183252 5:169540776-169540798 GTTGCAGCTTGGGTATCTATGGG + Intergenic
1002375672 5:178787424-178787446 GTTTTATCTTGGGGGACCAAAGG + Intergenic
1003045484 6:2729545-2729567 GTTTAGGGTTGGGGAACTAAGGG - Intronic
1005059186 6:21760685-21760707 GTTTCAGTTTGGGGATCTAAAGG + Intergenic
1005525426 6:26642842-26642864 GTTTTAGCCTGAGGAAATAAAGG - Intronic
1007742308 6:44020385-44020407 GTTCTAGCTGGGTCAACTAATGG + Intergenic
1013401987 6:109806769-109806791 GTTGCGGGTTGGGGAACTAGGGG - Intronic
1013637188 6:112040143-112040165 GTGGAAGCCTGGGGAAGTAAAGG + Intergenic
1014057450 6:117032839-117032861 GTTGTAGCTTGAGGAAGGAGTGG - Intergenic
1014168672 6:118253817-118253839 GCTGTAGCTTGAGGAATGAATGG + Intronic
1014986030 6:128010837-128010859 GGTGTATTTTGGGAAACTAAGGG + Intronic
1015020674 6:128470182-128470204 CTTGTAGTTTGGGGAACTCATGG + Intronic
1016173524 6:141049792-141049814 CATGTAATTTGGGGAACTAAAGG + Intergenic
1020406443 7:7840540-7840562 GTTGTAGACTGGGGGACTATGGG + Intronic
1020639452 7:10737368-10737390 GTTGGTGCTTGGAGAACTGAAGG - Intergenic
1023189492 7:37564346-37564368 GTTGGAGGGTGGGGAACAAAGGG - Intergenic
1026062615 7:67039518-67039540 ATTGTAACTTGGTGATCTAAAGG + Intronic
1026460571 7:70611387-70611409 GATGTAGCTTTGGGAATGAAAGG + Intronic
1029887212 7:103885584-103885606 GTTGTGGGTTGGGGGACTTAGGG + Intronic
1030094836 7:105889212-105889234 TTTGGAGATTGGGGATCTAAAGG - Intronic
1040974712 8:53177353-53177375 GTTGTAGAGTGGGTAACCAAGGG - Intergenic
1041149835 8:54919989-54920011 GATGTAGCTTGGTCAAGTAAAGG + Intergenic
1042466856 8:69138093-69138115 GTGGTAGCTTGGTAACCTAAAGG - Intergenic
1043855695 8:85262500-85262522 GTTGGAGCTTGGAGAATGAAGGG + Intronic
1045412410 8:101932050-101932072 GATGTAGCTTAGGGAGCTCAAGG - Intronic
1047215425 8:122872285-122872307 GTTGTAGCTCTGTGAACTGATGG - Intronic
1047581698 8:126223370-126223392 GTTGTAGATGGCAGAACTAAAGG - Intergenic
1047604669 8:126463278-126463300 GTTGTGGGGTGGGGAACTAGGGG + Intergenic
1047788493 8:128177687-128177709 GCTGGAGCTTGGGGTACCAATGG + Intergenic
1050857772 9:10382933-10382955 ATTGTCCCTTGGAGAACTAAAGG - Intronic
1051273493 9:15377225-15377247 GTTGCAGCTTGTGGCACTGATGG - Intergenic
1053614360 9:39747964-39747986 GTGGTAGCCTGGGGAACGTAAGG - Intergenic
1053872388 9:42505904-42505926 GTGGTAGCCTGGGGAACGTAAGG - Intergenic
1053900365 9:42790010-42790032 GTGGTAGCCTGGGGAACATAAGG + Intergenic
1054239157 9:62594428-62594450 GTGGTAGCCTGGGGAACGTAAGG + Intergenic
1054261274 9:62867588-62867610 GTGGTAGCCTGGGGAACGTAAGG - Intergenic
1054553289 9:66628950-66628972 GTGGTAGCCTGGGGAACGTAAGG + Intergenic
1054772905 9:69099758-69099780 GTTGTAGCCTTGGGAACCACAGG + Intronic
1058507591 9:105681952-105681974 GGAGTAGCATGGTGAACTAAGGG - Intergenic
1061917504 9:133762986-133763008 GTTGTGGCTGGGGGAGGTAATGG + Exonic
1203486053 Un_GL000224v1:56034-56056 GTTGTATCTTGGGGAACGGGGGG + Intergenic
1189402868 X:40688631-40688653 GTTGTAACTTGGGGAAAGGATGG - Intronic
1191140142 X:57107690-57107712 ATTGTGGATTGGGGACCTAAAGG + Intergenic
1191956177 X:66644720-66644742 ATAGTAGGTTGGGGAGCTAATGG - Intergenic
1194910352 X:99634268-99634290 CTAGTACCTTGGGGAACGAAAGG - Intergenic
1197637544 X:128931879-128931901 GTTTTAGCTTAGAGAACTTACGG - Intergenic
1198001707 X:132445940-132445962 GTTGGAGGGTGGGGAGCTAAGGG - Intronic