ID: 981076594

View in Genome Browser
Species Human (GRCh38)
Location 4:140598534-140598556
Sequence CTCCGCCATGAGCAAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981076587_981076594 18 Left 981076587 4:140598493-140598515 CCTTTTGAGAACATATTTCTTAA No data
Right 981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981076594 Original CRISPR CTCCGCCATGAGCAAGGCGC AGG Intergenic
No off target data available for this crispr