ID: 981078858

View in Genome Browser
Species Human (GRCh38)
Location 4:140618317-140618339
Sequence CAGCATCCTCACCCCCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981078858_981078861 1 Left 981078858 4:140618317-140618339 CCTTGGTGGGGGTGAGGATGCTG No data
Right 981078861 4:140618341-140618363 TGGGACATGAGCCTCCTTATTGG No data
981078858_981078865 19 Left 981078858 4:140618317-140618339 CCTTGGTGGGGGTGAGGATGCTG No data
Right 981078865 4:140618359-140618381 ATTGGCCGTGGCTCTCTTTGTGG No data
981078858_981078862 7 Left 981078858 4:140618317-140618339 CCTTGGTGGGGGTGAGGATGCTG No data
Right 981078862 4:140618347-140618369 ATGAGCCTCCTTATTGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981078858 Original CRISPR CAGCATCCTCACCCCCACCA AGG (reversed) Intergenic
No off target data available for this crispr