ID: 981078896

View in Genome Browser
Species Human (GRCh38)
Location 4:140618636-140618658
Sequence GATGACACCAGTGCAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981078896_981078901 15 Left 981078896 4:140618636-140618658 CCTTCCTCTGCACTGGTGTCATC No data
Right 981078901 4:140618674-140618696 TAGGAAGGACTGACAGAGATGGG 0: 1
1: 0
2: 0
3: 12
4: 323
981078896_981078899 0 Left 981078896 4:140618636-140618658 CCTTCCTCTGCACTGGTGTCATC No data
Right 981078899 4:140618659-140618681 ATTATTATATTAGCATAGGAAGG No data
981078896_981078903 17 Left 981078896 4:140618636-140618658 CCTTCCTCTGCACTGGTGTCATC No data
Right 981078903 4:140618676-140618698 GGAAGGACTGACAGAGATGGGGG No data
981078896_981078898 -4 Left 981078896 4:140618636-140618658 CCTTCCTCTGCACTGGTGTCATC No data
Right 981078898 4:140618655-140618677 CATCATTATTATATTAGCATAGG No data
981078896_981078902 16 Left 981078896 4:140618636-140618658 CCTTCCTCTGCACTGGTGTCATC No data
Right 981078902 4:140618675-140618697 AGGAAGGACTGACAGAGATGGGG 0: 1
1: 0
2: 2
3: 61
4: 578
981078896_981078900 14 Left 981078896 4:140618636-140618658 CCTTCCTCTGCACTGGTGTCATC No data
Right 981078900 4:140618673-140618695 ATAGGAAGGACTGACAGAGATGG No data
981078896_981078904 25 Left 981078896 4:140618636-140618658 CCTTCCTCTGCACTGGTGTCATC No data
Right 981078904 4:140618684-140618706 TGACAGAGATGGGGGTAAAGTGG 0: 1
1: 0
2: 0
3: 42
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981078896 Original CRISPR GATGACACCAGTGCAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr