ID: 981080818

View in Genome Browser
Species Human (GRCh38)
Location 4:140637396-140637418
Sequence GGCTGGCTGTACAGAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981080818 Original CRISPR GGCTGGCTGTACAGAAGTCC TGG (reversed) Intronic
900432467 1:2609367-2609389 GGCCGGCTGTGGAGAAGGCCAGG - Exonic
900594798 1:3475873-3475895 GGCTGGCTGGGCAGGTGTCCTGG + Intronic
903366359 1:22807688-22807710 GGAGGGCTCTACAGAATTCCCGG + Intronic
903814868 1:26057561-26057583 GGCTTCCTGGACAGAGGTCCTGG + Intronic
903981957 1:27195191-27195213 GCCTGGTTGGACAGAAGTCAGGG - Intergenic
905380374 1:37557504-37557526 GGAGGGCTGTGCAGAAGACCTGG + Intronic
905791857 1:40793892-40793914 GGCTGGGTGAACAGAACTCTGGG - Intronic
905793768 1:40803883-40803905 GGCTGAGTCTACAGAACTCCTGG + Intronic
908094528 1:60722544-60722566 TGCAGGCTGTACAGAAGGCATGG - Intergenic
908903640 1:68983905-68983927 GTCTTGATCTACAGAAGTCCTGG + Intergenic
912803191 1:112734553-112734575 GGGTGGCTTTACAGAATTGCTGG - Intergenic
913408858 1:118528036-118528058 TGCAGGCTGTAAAGAAATCCTGG + Intergenic
916484949 1:165250346-165250368 GGCAGGCTGTTCAGAATCCCTGG + Intronic
919002249 1:191847590-191847612 GGCTGGTTAGACAGAAGTTCTGG - Intergenic
919777681 1:201204993-201205015 GGCTGGCCATTCAGAAATCCTGG - Intronic
920073058 1:203317004-203317026 GGCTGGCTGGACAAAAGCCATGG + Intergenic
924739732 1:246788026-246788048 GGCTGGCTAGACGGAAGGCCTGG + Intergenic
1063317185 10:5017853-5017875 TGCAGGCTGTACAGAAGGCATGG + Intronic
1063379264 10:5574276-5574298 GGCTGGCTGTGCAGCAGGCCTGG - Intergenic
1064312177 10:14221268-14221290 GGCTGGCTGTCCATAGGTCAGGG + Intronic
1067562627 10:47314557-47314579 GGCTGCCTGGGCAGAAGGCCAGG - Intergenic
1068732264 10:60372669-60372691 GGCTGGCTCTGCAGAGGCCCCGG + Intronic
1069511004 10:69042530-69042552 TCCTGGCAGCACAGAAGTCCCGG - Intergenic
1077191447 11:1257455-1257477 GGGTGGCTGGACAGATGCCCAGG + Intronic
1077516312 11:3004050-3004072 TGCTGGCTGTGCAGACGCCCTGG - Intronic
1077734561 11:4775613-4775635 TGCAGGCTGTACAGAAATCATGG + Intronic
1078296397 11:10075701-10075723 GTCTGGCTGTACAGGAGGCATGG - Intronic
1078441615 11:11372946-11372968 GACTGGCTGTGCAGAGGTCAGGG - Intronic
1079055886 11:17206707-17206729 GGAAGGCTGCACAGAAGTCCAGG - Intronic
1080623211 11:34004938-34004960 GCCATGCTGTAAAGAAGTCCAGG + Intergenic
1083334080 11:61912804-61912826 GCCTGGCTGTACAGCATTCTTGG - Intronic
1089063245 11:115643216-115643238 GGCTGGATGTAAAGAACTTCCGG + Intergenic
1093086671 12:14873092-14873114 TGCTGGCTGAACAGCAATCCAGG - Intronic
1097037574 12:56133882-56133904 GGCTGGGTGAACAGGAGCCCTGG + Intronic
1101799482 12:108008357-108008379 GGCTGGCTGAGCAGAAGTGTAGG - Intergenic
1103274731 12:119701744-119701766 GCCTGCCTTTACAGAATTCCTGG - Exonic
1105431372 13:20340358-20340380 TCCTGTGTGTACAGAAGTCCCGG - Intergenic
1107012430 13:35681763-35681785 GGCTGGCTGCCCAGAGGCCCAGG + Intergenic
1107220028 13:37970846-37970868 GGGAGGCTGGACTGAAGTCCGGG + Intergenic
1108226549 13:48295373-48295395 GGCTTGCTGTCCTGAAATCCAGG - Intergenic
1109147037 13:58791586-58791608 TGCAGGCTGTACAGAAGGCATGG - Intergenic
1110902045 13:80836293-80836315 TGCAGGCTGTACAGAAGGCATGG + Intergenic
1111849409 13:93553461-93553483 GGCTGGCAGATCAGAAGGCCAGG + Intronic
1113339645 13:109409577-109409599 GGCTGACTGTGCAGGAGGCCAGG + Intergenic
1113542992 13:111123319-111123341 GGCTGGCTGTGGATAGGTCCAGG - Intronic
1113599184 13:111556157-111556179 GGCTGGCAGGACAGCACTCCTGG + Intergenic
1113740891 13:112711718-112711740 TCCTGGCTGTTCAGAATTCCAGG + Intronic
1114551009 14:23532932-23532954 GGCTGTCTGTGCTGAAGGCCTGG + Exonic
1114776017 14:25482365-25482387 GGCTGGATATGCAGAAGTTCAGG + Intergenic
1118309629 14:64682814-64682836 GGCTTCCTGGACAGAAGTCAGGG + Intergenic
1119718573 14:76875823-76875845 AGCTGGCTGGTCAGAAGTGCAGG + Intergenic
1121482798 14:94291575-94291597 GGCTGGCTGGGCAGAACCCCTGG + Intronic
1122443718 14:101753733-101753755 TGCAGGCTGTACAGAAGGCATGG - Intergenic
1124087634 15:26566101-26566123 TGCAGGCTGTAGAAAAGTCCTGG + Intronic
1124397733 15:29319377-29319399 GGCTGAGTGAACAGAGGTCCTGG + Intronic
1124578399 15:30929211-30929233 AGCTGTCTGTGCACAAGTCCAGG - Exonic
1127282636 15:57504941-57504963 GGCTGGCCCTAGAGCAGTCCTGG + Intronic
1129195020 15:73959082-73959104 GGCTGTGAATACAGAAGTCCTGG + Intergenic
1130074972 15:80680846-80680868 TGCAGGCTGTATAGAAGTCATGG + Intronic
1131135733 15:89933650-89933672 TGGGGGCTGTACAGAAGTTCAGG + Intergenic
1133038175 16:3046252-3046274 GGCTGGCTGAGCCGAAGGCCCGG + Intergenic
1133162337 16:3920419-3920441 GGCTGGCTGCAGGGAAGTCCAGG + Intergenic
1133909563 16:10052604-10052626 GGCTGGCGGTAAAGACCTCCCGG + Intronic
1135123305 16:19785284-19785306 GGCACCCTGTACAGAGGTCCTGG - Intronic
1136414735 16:30096199-30096221 GGCTCGGTGTAAACAAGTCCAGG - Exonic
1136452334 16:30360361-30360383 GGCTGAGTGAATAGAAGTCCTGG - Intronic
1137353065 16:47731432-47731454 GGCTGGCTGTTGAGAGGTCTAGG + Intergenic
1138409714 16:56829262-56829284 GGCTGATAGTACAGAAGTCCAGG + Intronic
1138528542 16:57622529-57622551 GGCTGGGCGTCCAGAAGTCTGGG - Intronic
1139230347 16:65277128-65277150 GGGAGGCTGGACTGAAGTCCTGG + Intergenic
1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG + Exonic
1140353485 16:74284880-74284902 TGCAGGCTGTACAGAAGGCATGG + Intergenic
1141035066 16:80619420-80619442 AGCTGGATTTCCAGAAGTCCAGG - Intronic
1141853824 16:86667291-86667313 GGCTGCTTGCACAGAAGTGCAGG - Intergenic
1143183628 17:4998320-4998342 GGCTGGCTGGACAGGAGGACGGG + Intronic
1144844556 17:18209697-18209719 GGCTTTGTGTACAGAGGTCCGGG + Exonic
1146845140 17:36177817-36177839 GGATGGATGGACAGTAGTCCAGG - Intronic
1146873361 17:36389666-36389688 GGATGGATGGACAGTAGTCCAGG - Intronic
1146880715 17:36440748-36440770 GGATGGATGGACAGTAGTCCAGG - Intergenic
1147202382 17:38811630-38811652 CTCTGGGTCTACAGAAGTCCAGG + Intronic
1149549825 17:57532047-57532069 TGCTGGCTCTCCAGGAGTCCTGG + Intronic
1150446435 17:65230245-65230267 GGCTAGCTGCACGGGAGTCCGGG + Intergenic
1151868057 17:76817984-76818006 TGCAGGCTGTACAGAAGGCATGG + Intergenic
1153987202 18:10362951-10362973 TGCAGGCTGTACAGAAAGCCTGG - Intergenic
1156395960 18:36700212-36700234 GGCTGGCAGTACAGACCTCAGGG - Intronic
1157936229 18:51875757-51875779 TGCAGGCTGTACAGAAGGCATGG + Intergenic
1159164722 18:64685468-64685490 GGGAGGCTGGACTGAAGTCCGGG - Intergenic
1161064658 19:2231657-2231679 GGCTGCCTGTCCTGAAGGCCAGG - Exonic
1161550747 19:4910728-4910750 GTCTGGCTGTACAGGAGGACTGG + Intronic
1164003786 19:21131246-21131268 GGAAGGCTGGACTGAAGTCCGGG + Intergenic
1165120685 19:33556608-33556630 GGCTGGCAGCACAGAGGTGCTGG - Intergenic
1165745164 19:38226315-38226337 TGCTGGCTCTACAGGGGTCCGGG - Intronic
1166383662 19:42368795-42368817 GGCAGGTGGTACAGAGGTCCAGG + Intronic
1168102269 19:54147554-54147576 GGGTGGCTGGAAAGAAGCCCAGG + Intronic
1168325474 19:55536662-55536684 GGCGGGCTGTGCAGAGGGCCTGG + Intronic
925823372 2:7822596-7822618 GCCTGGCTGGACAGCAGTCCTGG - Intergenic
928072695 2:28233285-28233307 GGCTGGCTGAAGAGAAGGCAGGG - Intronic
928232868 2:29515014-29515036 GACTGGCTGGAGAGAAGGCCAGG - Intronic
934092352 2:88563294-88563316 GGCAGGCTGCGCAGAAGGCCAGG - Intronic
934561747 2:95317208-95317230 GTCTGGCTGCAGAGAAGCCCTGG + Intronic
935851517 2:107225754-107225776 TGCAGGCTGTACAGAAATCATGG - Intergenic
936485207 2:112919450-112919472 GGCTGGCCGAACAGAAATCAGGG + Intergenic
941387933 2:164876045-164876067 GGCTATCAGTACAGAAGTCAAGG + Intergenic
941752585 2:169148782-169148804 GGCCGGCTGTTCAGAAGCTCAGG - Intronic
943806876 2:192134252-192134274 GGGAGGCTGTATTGAAGTCCGGG - Intronic
944159505 2:196643468-196643490 GGCTGAATGTACACATGTCCTGG + Intronic
945918763 2:215732858-215732880 AGATGGCTGTGCAGAAGACCTGG - Intergenic
946363311 2:219232714-219232736 GGCTGGGTGTACAAAAGGCTGGG - Intronic
948229443 2:236338934-236338956 GGCTGGCTGTTCAGCACCCCAGG + Intronic
948989642 2:241547044-241547066 GGCTGGAAGTCCAGAAGTCGGGG - Intergenic
1169112498 20:3043176-3043198 GGCAGGCTGTTCAGAGGTACAGG - Intergenic
1169303349 20:4465917-4465939 GGATAGCTGTACAGTAGTTCTGG - Intergenic
1169883777 20:10375578-10375600 AACTGGCTGTTCAGAAGTGCAGG - Intergenic
1170814996 20:19706373-19706395 GGCTGCCTATACAGAAGTTTAGG + Intronic
1171146997 20:22793449-22793471 GGCAGGCTGTACAGAAAGCATGG - Intergenic
1173744627 20:45426821-45426843 GGCTTGTTTTACAGAAATCCAGG - Intergenic
1174770841 20:53298606-53298628 GGCTTGCTGTGCAGAAGCCAGGG + Intronic
1175674258 20:60933399-60933421 GTGGGGCTGTACAGAGGTCCTGG - Intergenic
1175873438 20:62218956-62218978 GGAGGGCTGGACAGAAGTCCAGG - Intronic
1178358408 21:31927812-31927834 GGCTGGCTCTAGAAAAGGCCTGG - Intronic
1179136122 21:38681470-38681492 GGCAGGCTGTACAGAAAGCATGG - Intergenic
1179249528 21:39661446-39661468 GGCAGGCTCTAGAGAATTCCCGG + Exonic
1179281361 21:39936959-39936981 GGCTGGCTGACCACAAGCCCAGG - Intergenic
1180050258 21:45327812-45327834 GGCTGGGTGTGCAGCAGTGCGGG + Intergenic
1182194567 22:28502730-28502752 GGCTGTCAGTGCAGAAATCCTGG + Intronic
1183966764 22:41446908-41446930 GGCTGGCTGGGAAGTAGTCCCGG - Exonic
1184302571 22:43570871-43570893 GTCTTGCTGTGCAGAAGGCCTGG - Intronic
1185081327 22:48710907-48710929 GGCCAGGTGTACAGAAGTCCAGG + Intronic
949142401 3:650625-650647 GGGTGGCTGCACAGATGTTCTGG + Intergenic
949775279 3:7625727-7625749 GCCAGGCTGTGCAGAAGTCAGGG - Intronic
950143489 3:10631650-10631672 GGCTGGCCCTGCACAAGTCCTGG + Intronic
950948525 3:16975714-16975736 GACTAGTTGGACAGAAGTCCAGG + Intronic
953825469 3:46248179-46248201 GGGAGGCTGGACTGAAGTCCGGG + Intronic
954708045 3:52491543-52491565 GGCTGCCTGGACAGACGTCATGG + Intronic
957050252 3:75406199-75406221 AGCTGGTTGTTCAGAAGTTCTGG + Intergenic
957539296 3:81547505-81547527 GGCTGGCTGCACCAAAGCCCTGG - Intronic
960963918 3:123091517-123091539 GGCTGGCAGTGCTGAAATCCTGG + Intronic
963039595 3:141059035-141059057 GGCTGGGGGCACAGAAGTGCTGG + Intronic
963263681 3:143217812-143217834 GCCTGACTTAACAGAAGTCCAGG - Intergenic
964442584 3:156727530-156727552 CGCTGGCTGTCCACAGGTCCTGG - Intergenic
966491056 3:180529290-180529312 TGCAGGCTGTACAGAAGGCATGG + Intergenic
967844223 3:194031582-194031604 GGCTGGCTCTCCAGAGGTCAGGG + Intergenic
969580786 4:8063655-8063677 GCCTGGCTGTCCGCAAGTCCTGG + Intronic
969701140 4:8768493-8768515 GGGTTGCTGCACCGAAGTCCAGG + Intergenic
970044678 4:11838406-11838428 GGCTGGCACTATAGAAGGCCAGG - Intergenic
970123172 4:12779907-12779929 TGCAGGCTGTACAGAAGGCATGG - Intergenic
971172810 4:24250693-24250715 GGCTGGCCATTCAGAAGTCCAGG + Intergenic
972230514 4:37067299-37067321 GGCTGCATGGACAGAATTCCAGG + Intergenic
972942610 4:44215185-44215207 AGCTAGCTGTACAGGAGACCAGG - Intronic
976436991 4:85029666-85029688 GGCTGGCTGGCCAGAGGCCCAGG + Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
981080818 4:140637396-140637418 GGCTGGCTGTACAGAAGTCCTGG - Intronic
981408988 4:144405622-144405644 GGCAGGCTGTACAGGAGGCATGG + Intergenic
982353805 4:154444879-154444901 GGCTGGGTTTGCAGAACTCCAGG - Intronic
983648312 4:170014517-170014539 GGCTGCCTGCCCACAAGTCCAGG + Intronic
986500340 5:8391823-8391845 GGGTTCCTGTAAAGAAGTCCAGG + Intergenic
989566060 5:42902647-42902669 GTATGGCTTTACAAAAGTCCTGG + Intergenic
993275584 5:85852399-85852421 TGCTGCCTGAACAGAAGTCCTGG + Intergenic
994092056 5:95818276-95818298 GGCAGGCTGTACAGACGGCACGG + Intronic
995074110 5:107961063-107961085 GGCTGGCTGGAAAGAAGTGGGGG + Intronic
995560582 5:113376938-113376960 TGGTGGCTTCACAGAAGTCCTGG - Intronic
996723103 5:126648923-126648945 GGGAGGCTGGATAGAAGTCCGGG - Intergenic
997581018 5:135017082-135017104 GGCCTGCTGTACTGAAGCCCAGG - Intergenic
998011030 5:138695792-138695814 GGAAGGCTGCTCAGAAGTCCAGG + Intronic
999316619 5:150588372-150588394 GGCTGGGGTTGCAGAAGTCCAGG - Intergenic
1001367454 5:171158035-171158057 GGCTGGCTTTTCAGAAATACTGG - Intronic
1004488093 6:16087103-16087125 GCCTGGCTGTCCAGATGACCTGG + Intergenic
1006814497 6:36840730-36840752 TGCTGGCTGCATAGAAGCCCAGG - Intergenic
1007419922 6:41713184-41713206 GGCTGGGTGGCCAGGAGTCCTGG - Intronic
1010561971 6:77361975-77361997 AGCTGGCTGTAAAGAAAGCCTGG + Intergenic
1011631951 6:89335622-89335644 GGCTGGCTTTAAAAAAATCCAGG + Intronic
1013847378 6:114469935-114469957 GGCTGGCTGTACTGGAGGCCAGG + Intergenic
1014005670 6:116415011-116415033 AGATGGCTGTACAGCAGACCTGG - Intronic
1014851200 6:126341419-126341441 GGGTGGCAGTGGAGAAGTCCAGG - Intronic
1017265824 6:152444479-152444501 TTCTGGCTCTAAAGAAGTCCAGG - Exonic
1017890996 6:158639312-158639334 GGCTGGGGGGCCAGAAGTCCCGG + Intronic
1019310787 7:359701-359723 GCCTGGCTGTCCAGGGGTCCTGG - Intergenic
1019484683 7:1284117-1284139 GGCAGGGTCTGCAGAAGTCCCGG + Intergenic
1020316286 7:6907617-6907639 GGGAGGCTGGACTGAAGTCCGGG - Intergenic
1022819845 7:33948746-33948768 CTCTGGCTGTACAGAAGGCATGG - Intronic
1022858245 7:34338576-34338598 TGCAGGCTGTACAGGAGTCATGG + Intergenic
1023929598 7:44697248-44697270 AGCTGCCTGGCCAGAAGTCCAGG + Intronic
1024273439 7:47659331-47659353 GACTGGCTCTGCAGAAGCCCAGG + Exonic
1026136475 7:67666447-67666469 GACTGGCTGGTGAGAAGTCCGGG + Intergenic
1026136512 7:67666834-67666856 GACTGGCTGGTGAGAAGTCCGGG - Intergenic
1033883994 7:145921692-145921714 GGTTGGGTGTACAGCAGTTCAGG - Intergenic
1035042800 7:155942794-155942816 AGCTGGATGGACAGAAGTGCTGG + Intergenic
1035885012 8:3282052-3282074 AGCAGGCTGTACAGAAGGCATGG - Intronic
1039078626 8:33714738-33714760 TGCAGGCTGTACAGGAGGCCTGG + Intergenic
1042193812 8:66214566-66214588 GGCTGGAGGGACAAAAGTCCAGG - Intergenic
1046676053 8:117109899-117109921 GGCTGGCTTCACAGAAGAGCCGG + Intronic
1047022997 8:120796236-120796258 TGCAGGCTGTACAGGAATCCTGG - Intronic
1048329157 8:133460573-133460595 TGCTGGCTGTACTGAAGTTCAGG + Intronic
1057182831 9:93039136-93039158 GGCTGGCGGTTCTGAAGGCCAGG - Intergenic
1057437897 9:95058957-95058979 GGCTGCCTGGGCAGAAGTGCTGG + Intronic
1057496006 9:95561859-95561881 TGCTGGCTGTAAGGGAGTCCGGG + Intergenic
1057596330 9:96418486-96418508 GGCCGGCTGGAAAGAAGGCCAGG - Intergenic
1057894960 9:98901897-98901919 TGCAGGCTGTACAGAAATCATGG + Intergenic
1058721626 9:107769516-107769538 GGCTAACAGAACAGAAGTCCTGG - Intergenic
1061014235 9:127972732-127972754 GGCTGGCAGGACAGAGGACCGGG + Intronic
1061816734 9:133201844-133201866 GGGTGGACGTACAGAACTCCAGG + Intergenic
1062000086 9:134211514-134211536 TGGTGGCTGGAGAGAAGTCCAGG + Intergenic
1185966862 X:4615339-4615361 GGCTGGCTGTACAGAAGGCATGG + Intergenic
1187865737 X:23721528-23721550 GGCCAACTGTACAGCAGTCCTGG + Intronic
1192226002 X:69228374-69228396 GTCTGCATGTACAGAAATCCTGG + Intergenic
1201907178 Y:19097513-19097535 TGCTGTCTGTACAGAAGACATGG + Intergenic