ID: 981081619

View in Genome Browser
Species Human (GRCh38)
Location 4:140643600-140643622
Sequence TGCGGCAGAGGCAGCGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 586}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981081619_981081623 -9 Left 981081619 4:140643600-140643622 CCTCCGGCGCTGCCTCTGCCGCA 0: 1
1: 0
2: 2
3: 52
4: 586
Right 981081623 4:140643614-140643636 TCTGCCGCAGGAACCGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 64
981081619_981081625 3 Left 981081619 4:140643600-140643622 CCTCCGGCGCTGCCTCTGCCGCA 0: 1
1: 0
2: 2
3: 52
4: 586
Right 981081625 4:140643626-140643648 ACCGCCACAGGCACCTCCACTGG 0: 2
1: 0
2: 1
3: 17
4: 177
981081619_981081628 14 Left 981081619 4:140643600-140643622 CCTCCGGCGCTGCCTCTGCCGCA 0: 1
1: 0
2: 2
3: 52
4: 586
Right 981081628 4:140643637-140643659 CACCTCCACTGGCTCCTCCTTGG 0: 1
1: 1
2: 3
3: 64
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981081619 Original CRISPR TGCGGCAGAGGCAGCGCCGG AGG (reversed) Intronic