ID: 981081623

View in Genome Browser
Species Human (GRCh38)
Location 4:140643614-140643636
Sequence TCTGCCGCAGGAACCGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981081617_981081623 0 Left 981081617 4:140643591-140643613 CCAGGCCTTCCTCCGGCGCTGCC 0: 1
1: 0
2: 4
3: 26
4: 426
Right 981081623 4:140643614-140643636 TCTGCCGCAGGAACCGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 64
981081618_981081623 -5 Left 981081618 4:140643596-140643618 CCTTCCTCCGGCGCTGCCTCTGC 0: 1
1: 0
2: 1
3: 51
4: 470
Right 981081623 4:140643614-140643636 TCTGCCGCAGGAACCGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 64
981081616_981081623 6 Left 981081616 4:140643585-140643607 CCTGGGCCAGGCCTTCCTCCGGC 0: 1
1: 0
2: 6
3: 54
4: 531
Right 981081623 4:140643614-140643636 TCTGCCGCAGGAACCGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 64
981081614_981081623 9 Left 981081614 4:140643582-140643604 CCGCCTGGGCCAGGCCTTCCTCC 0: 1
1: 0
2: 7
3: 102
4: 956
Right 981081623 4:140643614-140643636 TCTGCCGCAGGAACCGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 64
981081619_981081623 -9 Left 981081619 4:140643600-140643622 CCTCCGGCGCTGCCTCTGCCGCA 0: 1
1: 0
2: 2
3: 52
4: 586
Right 981081623 4:140643614-140643636 TCTGCCGCAGGAACCGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981081623 Original CRISPR TCTGCCGCAGGAACCGCCAC AGG Intronic