ID: 981081625

View in Genome Browser
Species Human (GRCh38)
Location 4:140643626-140643648
Sequence ACCGCCACAGGCACCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981081622_981081625 -9 Left 981081622 4:140643612-140643634 CCTCTGCCGCAGGAACCGCCACA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 981081625 4:140643626-140643648 ACCGCCACAGGCACCTCCACTGG 0: 2
1: 0
2: 1
3: 17
4: 177
981081618_981081625 7 Left 981081618 4:140643596-140643618 CCTTCCTCCGGCGCTGCCTCTGC 0: 1
1: 0
2: 1
3: 51
4: 470
Right 981081625 4:140643626-140643648 ACCGCCACAGGCACCTCCACTGG 0: 2
1: 0
2: 1
3: 17
4: 177
981081617_981081625 12 Left 981081617 4:140643591-140643613 CCAGGCCTTCCTCCGGCGCTGCC 0: 1
1: 0
2: 4
3: 26
4: 426
Right 981081625 4:140643626-140643648 ACCGCCACAGGCACCTCCACTGG 0: 2
1: 0
2: 1
3: 17
4: 177
981081621_981081625 0 Left 981081621 4:140643603-140643625 CCGGCGCTGCCTCTGCCGCAGGA 0: 1
1: 0
2: 0
3: 26
4: 283
Right 981081625 4:140643626-140643648 ACCGCCACAGGCACCTCCACTGG 0: 2
1: 0
2: 1
3: 17
4: 177
981081619_981081625 3 Left 981081619 4:140643600-140643622 CCTCCGGCGCTGCCTCTGCCGCA 0: 1
1: 0
2: 2
3: 52
4: 586
Right 981081625 4:140643626-140643648 ACCGCCACAGGCACCTCCACTGG 0: 2
1: 0
2: 1
3: 17
4: 177
981081616_981081625 18 Left 981081616 4:140643585-140643607 CCTGGGCCAGGCCTTCCTCCGGC 0: 1
1: 0
2: 6
3: 54
4: 531
Right 981081625 4:140643626-140643648 ACCGCCACAGGCACCTCCACTGG 0: 2
1: 0
2: 1
3: 17
4: 177
981081614_981081625 21 Left 981081614 4:140643582-140643604 CCGCCTGGGCCAGGCCTTCCTCC 0: 1
1: 0
2: 7
3: 102
4: 956
Right 981081625 4:140643626-140643648 ACCGCCACAGGCACCTCCACTGG 0: 2
1: 0
2: 1
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981081625 Original CRISPR ACCGCCACAGGCACCTCCAC TGG Intronic