ID: 981081628

View in Genome Browser
Species Human (GRCh38)
Location 4:140643637-140643659
Sequence CACCTCCACTGGCTCCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 1, 2: 3, 3: 64, 4: 471}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981081624_981081628 -4 Left 981081624 4:140643618-140643640 CCGCAGGAACCGCCACAGGCACC 0: 1
1: 0
2: 3
3: 26
4: 218
Right 981081628 4:140643637-140643659 CACCTCCACTGGCTCCTCCTTGG 0: 1
1: 1
2: 3
3: 64
4: 471
981081619_981081628 14 Left 981081619 4:140643600-140643622 CCTCCGGCGCTGCCTCTGCCGCA 0: 1
1: 0
2: 2
3: 52
4: 586
Right 981081628 4:140643637-140643659 CACCTCCACTGGCTCCTCCTTGG 0: 1
1: 1
2: 3
3: 64
4: 471
981081617_981081628 23 Left 981081617 4:140643591-140643613 CCAGGCCTTCCTCCGGCGCTGCC 0: 1
1: 0
2: 4
3: 26
4: 426
Right 981081628 4:140643637-140643659 CACCTCCACTGGCTCCTCCTTGG 0: 1
1: 1
2: 3
3: 64
4: 471
981081621_981081628 11 Left 981081621 4:140643603-140643625 CCGGCGCTGCCTCTGCCGCAGGA 0: 1
1: 0
2: 0
3: 26
4: 283
Right 981081628 4:140643637-140643659 CACCTCCACTGGCTCCTCCTTGG 0: 1
1: 1
2: 3
3: 64
4: 471
981081616_981081628 29 Left 981081616 4:140643585-140643607 CCTGGGCCAGGCCTTCCTCCGGC 0: 1
1: 0
2: 6
3: 54
4: 531
Right 981081628 4:140643637-140643659 CACCTCCACTGGCTCCTCCTTGG 0: 1
1: 1
2: 3
3: 64
4: 471
981081618_981081628 18 Left 981081618 4:140643596-140643618 CCTTCCTCCGGCGCTGCCTCTGC 0: 1
1: 0
2: 1
3: 51
4: 470
Right 981081628 4:140643637-140643659 CACCTCCACTGGCTCCTCCTTGG 0: 1
1: 1
2: 3
3: 64
4: 471
981081622_981081628 2 Left 981081622 4:140643612-140643634 CCTCTGCCGCAGGAACCGCCACA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 981081628 4:140643637-140643659 CACCTCCACTGGCTCCTCCTTGG 0: 1
1: 1
2: 3
3: 64
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981081628 Original CRISPR CACCTCCACTGGCTCCTCCT TGG Intronic