ID: 981083958

View in Genome Browser
Species Human (GRCh38)
Location 4:140663707-140663729
Sequence GATAGGACTTCCCCTCTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981083958_981083959 -7 Left 981083958 4:140663707-140663729 CCTATAAGAGGGGAAGTCCTATC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 981083959 4:140663723-140663745 TCCTATCATTTTTGATAACATGG 0: 1
1: 2
2: 50
3: 345
4: 1269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981083958 Original CRISPR GATAGGACTTCCCCTCTTAT AGG (reversed) Intronic
905419817 1:37833721-37833743 GATAGGAGTTGCTCTTTTATTGG + Intronic
907719187 1:56955508-56955530 AATAGGACTACCTGTCTTATGGG - Intronic
912514039 1:110207044-110207066 GATAGGGCCTCCCCGCTCATGGG - Intergenic
918306562 1:183252043-183252065 GGTATTACTTCCCCTCTGATAGG - Exonic
1064173213 10:13052013-13052035 GATAGGAGGGCCCCTTTTATGGG + Intronic
1065239453 10:23691327-23691349 CATAGGACTTACCTTCCTATAGG - Intergenic
1065434269 10:25691236-25691258 GATAGGACTTCCTCTCATCATGG - Intergenic
1065980999 10:30897244-30897266 GCTAGTACTTCCCTTTTTATAGG - Intronic
1071182621 10:83004633-83004655 CATATGACTTCCACTCTTATTGG + Intergenic
1080125168 11:28724873-28724895 GATATTGCTTGCCCTCTTATAGG + Intergenic
1080614927 11:33937506-33937528 AATAGGACTTCCTGTCTGATCGG + Intergenic
1081160491 11:39742783-39742805 TATAGCACTACCCCTCTTACTGG - Intergenic
1093741164 12:22691609-22691631 GAAAGGAATTGTCCTCTTATTGG + Intergenic
1096937859 12:55303620-55303642 TATTGGTCTTCCCCTTTTATAGG + Intergenic
1099924259 12:88998267-88998289 TAAAGGCTTTCCCCTCTTATAGG - Intergenic
1106771046 13:32960864-32960886 GATAGAATTTCACATCTTATTGG - Intergenic
1107710069 13:43142720-43142742 GTTAGGACTTCCTATCTTTTTGG - Intergenic
1109787149 13:67192750-67192772 GAAAGGACTATCCCTCTTACAGG - Intronic
1111884983 13:94009152-94009174 GGTAGGATTTCCCCCCTAATAGG + Intronic
1112480577 13:99771373-99771395 CATAGAACTTCATCTCTTATGGG + Intronic
1113157924 13:107346440-107346462 GACAGGACTTCCCTTTTTAAAGG - Intronic
1116427430 14:44807917-44807939 GATAGGATTTGTTCTCTTATAGG + Intergenic
1120523935 14:85556045-85556067 GATAGGATTTCCCAACTTAATGG - Intronic
1121264004 14:92587351-92587373 GAAAGGGCTTCCCTTCTTGTGGG - Intronic
1136651133 16:31672400-31672422 GATATGACTTCACTTCCTATGGG + Intergenic
1137894763 16:52199359-52199381 CAAAGTTCTTCCCCTCTTATAGG - Intergenic
1146788854 17:35740319-35740341 GAGAGCACTGCCCCTCTGATGGG + Intronic
1158298206 18:56022703-56022725 TATAGGGCTTCCAGTCTTATGGG - Intergenic
1158749341 18:60240716-60240738 GAAAGGACTTCCTATTTTATTGG - Intergenic
1159894680 18:73985107-73985129 GATGGGGCTTCCCTTCCTATAGG + Intergenic
1162272991 19:9631444-9631466 GATAGGACTTCCCTCATTAGGGG - Intronic
930649339 2:53948905-53948927 CATTGAACTTCCCCTTTTATAGG - Intronic
940970426 2:159891092-159891114 CATTGGACTTCCCCTCTTGTGGG - Intronic
942791494 2:179766274-179766296 GAGGTGACTTCCCCTCTTCTGGG - Intronic
947530270 2:230904745-230904767 AATAGGACTTCCCATATTAATGG - Intergenic
948657892 2:239487879-239487901 GAGACGACTTCCCCTGTTGTAGG - Intergenic
948763344 2:240206214-240206236 GAGATGTCTTCCACTCTTATTGG - Intergenic
1178398981 21:32267073-32267095 GAGGGGACTTCCCCTGTTGTGGG - Intergenic
1183360261 22:37379634-37379656 TGTAGGACGTCCCCTCTCATGGG + Intronic
1185381899 22:50512989-50513011 GGTAGGACTTCCTCTGTCATGGG + Intronic
961997390 3:131260161-131260183 GACAGAACTTCCCCTCTAAAAGG - Intronic
969133201 4:5007369-5007391 GACAGGACTTTCCCCCTTTTTGG - Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
978161121 4:105549628-105549650 GATGAGACTGCCCCTTTTATTGG + Intergenic
979824106 4:125211527-125211549 TATAGGAGTTCTCCTTTTATGGG - Intergenic
981083958 4:140663707-140663729 GATAGGACTTCCCCTCTTATAGG - Intronic
982070809 4:151692837-151692859 GGTAGGACTTACCCTATTAGAGG - Intronic
991211387 5:64108581-64108603 GATAGGACATCCTCACTTTTTGG - Intergenic
994679513 5:102868003-102868025 GCTAGGGCTTTCCCTCTTTTAGG + Intronic
1004211605 6:13651733-13651755 GATAGGACTTCAGTTTTTATGGG - Intronic
1008394648 6:50992565-50992587 GATAGGCATTCCCCTACTATTGG - Intergenic
1017026851 6:150188783-150188805 GCTAGGAATTACCTTCTTATGGG + Intronic
1021601183 7:22365349-22365371 GATAGCACTGCCTTTCTTATAGG + Intergenic
1031521324 7:122770005-122770027 GCTAGTACTTCCTATCTTATGGG - Intronic
1036236091 8:7041059-7041081 GAAAGGACTTCCCCTATTTAAGG + Intergenic
1040549877 8:48429639-48429661 GATGGGCCTTCCCCTCATGTCGG - Intergenic
1040781048 8:51109867-51109889 GATTGGATTTTCCTTCTTATGGG + Intergenic
1048590082 8:135813251-135813273 GGTAGGACTTGAGCTCTTATTGG - Intergenic
1056045781 9:82714127-82714149 GATGGGACTCCTCCTCTTTTTGG - Intergenic
1187612437 X:20956955-20956977 GATATGTCTTTCCCTCTTCTTGG + Intergenic
1192198614 X:69049055-69049077 GATAAGAATTCCTCTCTCATGGG - Intergenic