ID: 981088231

View in Genome Browser
Species Human (GRCh38)
Location 4:140705640-140705662
Sequence CTAGTATTCTACATCAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981088231_981088235 -7 Left 981088231 4:140705640-140705662 CCTCTATTGATGTAGAATACTAG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 981088235 4:140705656-140705678 ATACTAGGAGATGGGAAATCTGG 0: 1
1: 0
2: 1
3: 27
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981088231 Original CRISPR CTAGTATTCTACATCAATAG AGG (reversed) Intronic
914834104 1:151192820-151192842 CTAGTGTTCTATATCACTGGGGG + Intronic
923995654 1:239491259-239491281 CTAGTGTTCTACAGCACTATAGG - Intronic
1064587509 10:16853284-16853306 CTTGTATTCTACACAAATATAGG + Intronic
1065508163 10:26450620-26450642 CTAGTTTTCCACAGCCATAGTGG - Intronic
1070235436 10:74620182-74620204 CTAGTGTTCTACAGCAATGTAGG - Intronic
1071117652 10:82241736-82241758 CTTGTATTCTAAATCACTGGGGG - Intronic
1071938807 10:90563440-90563462 CTAGTTTTCTACAGCACTATAGG - Intergenic
1074645270 10:115443130-115443152 CTTTTCTTTTACATCAATAGAGG - Intronic
1074940057 10:118226856-118226878 CTAATATTCTTCATGAGTAGAGG + Intergenic
1077970665 11:7186365-7186387 CTAGTGTTCTACAGCATTATAGG - Intergenic
1079455154 11:20630046-20630068 CTAGTATTCTATAGCACTATAGG - Intronic
1080233180 11:30040907-30040929 CTGGTTTACTACATCAGTAGCGG + Intergenic
1081335999 11:41867998-41868020 CTAGTTTTCTACCTGGATAGTGG + Intergenic
1082901600 11:58259757-58259779 CTAGTGTTCTACAGCATTATAGG - Intergenic
1085551568 11:77378169-77378191 CTAATATGCTAAATTAATAGTGG - Intronic
1085670313 11:78458041-78458063 CTGGTATTCTGCAGCAATATAGG + Intronic
1086366530 11:86112379-86112401 CTAGTGTTCTACAGCACTGGAGG - Intergenic
1087558429 11:99752658-99752680 ATAGTTTTCTACATAAATAAAGG + Intronic
1090566521 11:127998392-127998414 CTGATATTTTACATCAAAAGAGG + Intergenic
1091934077 12:4421487-4421509 CTAGTATCCTACATCACTGTAGG - Intergenic
1097475125 12:60045138-60045160 CTAGTATTCTACAGCACTGTAGG - Intergenic
1097495880 12:60333206-60333228 CTAGTATTTTACTTGAATACTGG + Intergenic
1099603782 12:84775679-84775701 CTTGTATTCTAAATCATTTGGGG - Intergenic
1104697366 12:130873029-130873051 CTAGTGTTCCACACCAACAGAGG + Exonic
1108131275 13:47303162-47303184 CTATTATTATACATCAATTATGG - Intergenic
1108861224 13:54861796-54861818 CTAGCATTCAACATCAATAAGGG - Intergenic
1109194695 13:59365466-59365488 CTAGTGTTCTACACCATTATAGG - Intergenic
1114788328 14:25626585-25626607 CTAGTATGCTACCTGAATAATGG + Intergenic
1116089154 14:40282150-40282172 CTAGTAATCTAAATCATCAGAGG + Intergenic
1124198122 15:27651443-27651465 CTAGTGTTCTAGAGCACTAGAGG + Intergenic
1127572037 15:60253029-60253051 TTAGTATTCTACAAGAAAAGAGG + Intergenic
1127852167 15:62923443-62923465 CTAGTATTCTATAGCATTACAGG + Intergenic
1131096378 15:89656830-89656852 CAAATATTCTAAATCAATTGGGG + Intergenic
1131888413 15:96945511-96945533 CTGGTACTTTACATCAACAGGGG + Intergenic
1135875493 16:26196248-26196270 CTAGTTTTCTAATTCAATAACGG - Intergenic
1151862863 17:76778673-76778695 CTAGTATTCTAAATCAAGGCAGG - Intronic
1152482338 17:80563000-80563022 CTACCATCCTGCATCAATAGTGG + Intronic
928783393 2:34852426-34852448 CTAGTTTTCTACAGCACTATAGG - Intergenic
928937146 2:36690549-36690571 CTACTATTCAACATCTCTAGAGG - Intergenic
929182446 2:39057077-39057099 TAAGTATTTTACATCATTAGAGG - Intronic
932989705 2:76771783-76771805 CAAGAATTCTACAGCATTAGAGG - Intronic
933819543 2:86097814-86097836 CTAGTGTTCTACACCATTATAGG + Intronic
940558985 2:155269612-155269634 CTAATATTGTACTTCAAGAGTGG + Intergenic
940580926 2:155579018-155579040 CTAGTATTCTACAGCACTGTAGG + Intergenic
1172562008 20:35897511-35897533 CTAGCATTCTACAGCACTATGGG - Intronic
1174948120 20:55011287-55011309 CTAGTATTCTACATGGCTATAGG + Intergenic
1177512159 21:22102169-22102191 CAAGTATTCTAAATCCATTGTGG + Intergenic
1181063709 22:20295111-20295133 CTAGTGTTCTACACCAATGTAGG - Intergenic
951102065 3:18700025-18700047 CTAATTTTTTACATCAAAAGTGG + Intergenic
953100614 3:39822609-39822631 CTAGTGTTCTACAGCATTACAGG - Intronic
953215715 3:40915874-40915896 CTAGTATTGTACAGTAATAAAGG - Intergenic
953527024 3:43700225-43700247 CTAGGATTCTATATTTATAGTGG + Intronic
955316142 3:57940779-57940801 CTAGAATTCTAAAGCACTAGAGG + Intergenic
957878455 3:86179609-86179631 CTCGTAGTCTAAATCAATAATGG - Intergenic
961965751 3:130900974-130900996 CTAGGTTTCTACATCATCAGGGG + Intronic
963747854 3:149143226-149143248 TTACTATTCTTCATCCATAGTGG + Intronic
965377892 3:167949081-167949103 CTAGTATTCTATAGCAATGTAGG + Intergenic
965796186 3:172441038-172441060 CTAGTATACTAAACCTATAGTGG + Intergenic
966655800 3:182357739-182357761 CTGAGATTCTACATGAATAGGGG - Intergenic
974798336 4:66782270-66782292 CTAGTAATTTACATAAATAATGG + Intergenic
974809292 4:66925042-66925064 CTTGTATGCTGCATCAACAGTGG + Intergenic
976325467 4:83766539-83766561 CTATTATTCTCCTTCAGTAGAGG - Intergenic
979051255 4:115935956-115935978 TTAGTATTCTACCTTAATAAAGG - Intergenic
980531457 4:134061000-134061022 CTAGTATTTTCCAGCAAAAGAGG + Intergenic
981088231 4:140705640-140705662 CTAGTATTCTACATCAATAGAGG - Intronic
983838429 4:172423038-172423060 TTGGTATTCTACATTTATAGAGG + Intronic
983950497 4:173634205-173634227 CTAGTGTTCCACACCAACAGAGG - Intergenic
984909593 4:184660543-184660565 AAAGTATTCTAAATCAATATAGG - Intronic
988662250 5:33284198-33284220 CTGGCATTTTAGATCAATAGTGG - Intergenic
992664660 5:78995354-78995376 CTACTATTCTAATTCATTAGTGG + Intergenic
994919676 5:106027843-106027865 CTAGTGTTTTAAATCACTAGAGG + Intergenic
997125302 5:131220599-131220621 CTTGTTTTCTACATCTATAATGG - Intergenic
1003852568 6:10240351-10240373 CTAGTTTACTACTTTAATAGAGG - Intergenic
1004373716 6:15074335-15074357 CTGGCTTTCTACATCAATGGAGG + Intergenic
1008776308 6:55042767-55042789 CTAGTGTTCTATAGCACTAGAGG - Intergenic
1014521742 6:122452228-122452250 CTAGAATTCTTCAGCAATAAAGG - Intronic
1017078179 6:150639465-150639487 CTAGTGTTCTAGATCACCAGAGG - Intronic
1018074359 6:160197955-160197977 CTAGTATTCTATACCACTATAGG + Intronic
1020587489 7:10087347-10087369 CTTGTATGCTACCTTAATAGCGG + Intergenic
1021127790 7:16873519-16873541 GTAGTATTCTACAGCACTATAGG + Intronic
1029626887 7:101725466-101725488 CTAAAAATCCACATCAATAGTGG - Intergenic
1035995056 8:4537018-4537040 CTTATATTAAACATCAATAGTGG + Intronic
1043154872 8:76766076-76766098 TAAGTATTATACATAAATAGGGG + Intronic
1044062738 8:87659630-87659652 CTAGTCTTTTCCATCAATAAGGG - Intergenic
1045310946 8:101002230-101002252 CTAACATTATACATTAATAGAGG - Intergenic
1046355976 8:113085847-113085869 CTAGTGTTCTAGAACAATAGAGG + Intronic
1046452016 8:114405852-114405874 CTAGTGTTCTACAGCATTATAGG + Intergenic
1050742608 9:8839629-8839651 CTAGTATTCTCAATCATTACTGG + Intronic
1053525606 9:38827207-38827229 ATATTATTCTACATCACTAAAGG - Intergenic
1054197838 9:62051641-62051663 ATATTATTCTACATCACTAAAGG - Intergenic
1054640516 9:67536731-67536753 ATATTATTCTACATCACTAAAGG + Intergenic
1056227801 9:84513287-84513309 CTTGTTTTCTTCATCAAAAGGGG + Intergenic
1188220914 X:27540643-27540665 CTAGTGTTCTATATCACTATAGG + Intergenic
1188692167 X:33142987-33143009 CTATTGTTAAACATCAATAGAGG + Intronic
1188902192 X:35747237-35747259 CTAGTGTTCTATATCACTATAGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1192291702 X:69803727-69803749 CTAGTATTCTACACCAATGTAGG - Intronic
1192350514 X:70352202-70352224 CTAGGCTTGTACATTAATAGAGG + Intronic
1195510331 X:105708839-105708861 CTAGATTTCTAAATCAATATGGG + Intronic
1196634478 X:117986182-117986204 CTAGCATTCTACAGCAGCAGAGG + Intronic