ID: 981093439

View in Genome Browser
Species Human (GRCh38)
Location 4:140756208-140756230
Sequence GCTGGGGCTTTGTTGTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981093439_981093455 13 Left 981093439 4:140756208-140756230 CCGGGCCACAACAAAGCCCCAGC 0: 1
1: 0
2: 2
3: 30
4: 227
Right 981093455 4:140756244-140756266 GGACGGTGAGGACGCGGGCGCGG 0: 1
1: 0
2: 1
3: 35
4: 260
981093439_981093445 -8 Left 981093439 4:140756208-140756230 CCGGGCCACAACAAAGCCCCAGC 0: 1
1: 0
2: 2
3: 30
4: 227
Right 981093445 4:140756223-140756245 GCCCCAGCAGGCGGCCCGGGAGG 0: 1
1: 0
2: 2
3: 36
4: 338
981093439_981093453 7 Left 981093439 4:140756208-140756230 CCGGGCCACAACAAAGCCCCAGC 0: 1
1: 0
2: 2
3: 30
4: 227
Right 981093453 4:140756238-140756260 CCGGGAGGACGGTGAGGACGCGG 0: 1
1: 0
2: 0
3: 30
4: 302
981093439_981093449 -4 Left 981093439 4:140756208-140756230 CCGGGCCACAACAAAGCCCCAGC 0: 1
1: 0
2: 2
3: 30
4: 227
Right 981093449 4:140756227-140756249 CAGCAGGCGGCCCGGGAGGACGG 0: 1
1: 0
2: 0
3: 41
4: 360
981093439_981093454 8 Left 981093439 4:140756208-140756230 CCGGGCCACAACAAAGCCCCAGC 0: 1
1: 0
2: 2
3: 30
4: 227
Right 981093454 4:140756239-140756261 CGGGAGGACGGTGAGGACGCGGG 0: 1
1: 0
2: 1
3: 12
4: 250
981093439_981093450 1 Left 981093439 4:140756208-140756230 CCGGGCCACAACAAAGCCCCAGC 0: 1
1: 0
2: 2
3: 30
4: 227
Right 981093450 4:140756232-140756254 GGCGGCCCGGGAGGACGGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981093439 Original CRISPR GCTGGGGCTTTGTTGTGGCC CGG (reversed) Intergenic