ID: 981093679

View in Genome Browser
Species Human (GRCh38)
Location 4:140757333-140757355
Sequence GTCTAGGGATAAAGCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981093679_981093685 14 Left 981093679 4:140757333-140757355 CCAGGGCAGCTTTATCCCTAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 981093685 4:140757370-140757392 CAAATACTTCGAGCTTCCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981093679 Original CRISPR GTCTAGGGATAAAGCTGCCC TGG (reversed) Intergenic