ID: 981093679

View in Genome Browser
Species Human (GRCh38)
Location 4:140757333-140757355
Sequence GTCTAGGGATAAAGCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981093679_981093685 14 Left 981093679 4:140757333-140757355 CCAGGGCAGCTTTATCCCTAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 981093685 4:140757370-140757392 CAAATACTTCGAGCTTCCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981093679 Original CRISPR GTCTAGGGATAAAGCTGCCC TGG (reversed) Intergenic
900705115 1:4075743-4075765 AGCTGGTGATAAAGCTGCCCTGG + Intergenic
901761218 1:11473010-11473032 GGCCAGGGTTAAAGCTGACCTGG + Intergenic
902277609 1:15350739-15350761 GGCTTGGGATACACCTGCCCTGG + Intronic
904040575 1:27582107-27582129 GTCCAGGGATGGAGCTGCGCTGG - Intronic
906758488 1:48346738-48346760 ATCTAGGGATACAGCTAACCAGG + Intronic
912447977 1:109751901-109751923 GTCCAGGGATGGAGCTGCCAAGG - Intronic
912514290 1:110208363-110208385 GTAAAGGGAGAAAGCTGCCAGGG - Intergenic
918185255 1:182121128-182121150 GTCTAGGGGAGGAGCTGCCCTGG + Intergenic
919446973 1:197718857-197718879 GTCTAGAGATAAAGCTGGATTGG + Intronic
920554608 1:206895551-206895573 GTCTAGGATTTCAGCTGCCCTGG + Intergenic
1063382105 10:5591946-5591968 TTCTAGGGATACATCTGCCAAGG - Intergenic
1063462480 10:6223375-6223397 GTCTAGGGATTCAGCTGCACTGG - Intronic
1065960844 10:30732843-30732865 GTCAAGGGGTAAACCTGCCAGGG - Intergenic
1071043067 10:81337489-81337511 GTATAGGGGCAGAGCTGCCCAGG + Intergenic
1071506670 10:86236551-86236573 GCCTAGGGCTCAAGCTGTCCTGG - Intronic
1072503455 10:96042341-96042363 GTCCAGGGAGAAGGCTGCCCTGG - Intergenic
1073459693 10:103659568-103659590 GGCTGAGGACAAAGCTGCCCAGG + Intronic
1073650859 10:105356634-105356656 GGCTCGGGAAAAATCTGCCCTGG + Intergenic
1079027671 11:16961587-16961609 TTCTGGGGATGATGCTGCCCAGG - Intronic
1087792391 11:102420334-102420356 GTCTAGGCATAGATCTGACCTGG + Intronic
1093778439 12:23105147-23105169 GTCTAAAGGTAAAGCAGCCCTGG + Intergenic
1093982663 12:25491763-25491785 GTTTAGGGGTTAAGCTTCCCTGG - Intronic
1096052589 12:48624197-48624219 GTCTAGGGGTAAAGACGTCCAGG + Intergenic
1099711738 12:86235137-86235159 TTCATGGGAAAAAGCTGCCCTGG - Intronic
1102360717 12:112285318-112285340 GTCTAGGGATAGAGCATTCCAGG - Intronic
1108489693 13:50969193-50969215 GCCTATGGAAAAAGCTGACCAGG + Intronic
1108977991 13:56473520-56473542 GTCTAGGAATACAGCTACCCAGG - Intergenic
1118317046 14:64731830-64731852 GGCTAGGGAACAAGATGCCCAGG + Intronic
1124437995 15:29666766-29666788 GTCTATGGTTACAGCAGCCCTGG - Intergenic
1129385401 15:75193437-75193459 GACTAGGCAGAAAGCAGCCCAGG - Intergenic
1133015246 16:2936738-2936760 CTCTGGGGACAAAGCTGCTCAGG - Intronic
1138269967 16:55688817-55688839 CTCAAGGGAAAGAGCTGCCCAGG - Intronic
1140456327 16:75107652-75107674 CTCTTGGGATGCAGCTGCCCTGG + Intronic
1142528226 17:560258-560280 GTCCAGCCATAAGGCTGCCCAGG - Intronic
1144418915 17:15077769-15077791 GTCTAGGAATAACAGTGCCCTGG - Intergenic
1146917066 17:36684820-36684842 GTCTTGGGTCCAAGCTGCCCTGG + Intergenic
1147695396 17:42348633-42348655 GACTAGGGATAAAGATGCTCTGG + Intronic
1152317069 17:79587371-79587393 GTCTTGGGATCAGGCTGCCGTGG - Intergenic
1152879395 17:82806713-82806735 GACTGGGGAGAAACCTGCCCTGG - Intronic
1161017666 19:1991257-1991279 GTCTTGGGATGGAGCTGCCGGGG - Intronic
1163321321 19:16576705-16576727 GTCTGGGGAAAAGCCTGCCCGGG + Exonic
1164099848 19:22045004-22045026 TTCTATGGAGAAAGCTGGCCGGG + Intergenic
1164297651 19:23927671-23927693 TTGTAGGGATAGAGTTGCCCAGG + Intronic
1164473488 19:28554945-28554967 ATCTTAGGATAGAGCTGCCCAGG + Intergenic
925705266 2:6678803-6678825 AGCTAGGCAGAAAGCTGCCCAGG - Intergenic
927745296 2:25613992-25614014 TTCTTGGGATAAAGCTCCCTGGG - Intronic
928381140 2:30819870-30819892 GTCTATAGAAAAAGCTGCACTGG - Intronic
932028955 2:68163825-68163847 GTCTGAGGTTGAAGCTGCCCAGG + Intronic
935097308 2:99957989-99958011 TTCTAGGGGTAAAACTGCCCAGG - Intronic
937090125 2:119200730-119200752 CTCTAGAGAACAAGCTGCCCTGG + Intergenic
937092810 2:119217770-119217792 GTCTAGGGGCACAGCTACCCAGG - Intergenic
937095102 2:119230070-119230092 GGCTTGAGATAAAGATGCCCGGG + Intronic
938568370 2:132540587-132540609 GGTTGGGGATAAAGCTGCCAAGG + Intronic
938731165 2:134149081-134149103 CTGGAGGGATAAAGCTCCCCAGG - Intronic
941513315 2:166440780-166440802 GTCTTGGGATTTATCTGCCCTGG - Intronic
947666448 2:231908948-231908970 GTCTAGGGAAACGGCTGTCCAGG + Intergenic
949007257 2:241656648-241656670 GTCCAGGGACAAATCAGCCCTGG - Intronic
1170555966 20:17514859-17514881 GCATAGGGGTAAAGCTGGCCGGG + Intronic
1170657747 20:18305598-18305620 GGGCAGGGATAAGGCTGCCCTGG - Intronic
1171194544 20:23187016-23187038 GTCTGTGGTTTAAGCTGCCCGGG - Intergenic
1173386802 20:42595842-42595864 GCCTAGAGACAAGGCTGCCCAGG + Intronic
1179814032 21:43891956-43891978 GTATAGGAATATAGCTGCCATGG - Intronic
1182834843 22:33333483-33333505 GGCTAGGAACAAAGCTGACCAGG - Intronic
951025335 3:17822450-17822472 GTACAGAGATAGAGCTGCCCTGG + Intronic
952594275 3:34997005-34997027 GTCTAGGGATAAAGCTAATAAGG + Intergenic
953491601 3:43357115-43357137 ATCTAGGAATACAGCTGACCAGG + Intronic
962922608 3:139964571-139964593 GTCAAGGGGCCAAGCTGCCCTGG + Intronic
964716325 3:159726331-159726353 GTCTAGGGATAAAGAATTCCAGG + Intronic
965687952 3:171325328-171325350 GTCTAGGGATTAAGAAGCTCTGG + Intronic
966194308 3:177298114-177298136 GCCTGGGGAGAGAGCTGCCCAGG + Intergenic
966773905 3:183527571-183527593 TTCTAGGCACAAAGCTCCCCTGG + Intronic
968086310 3:195875497-195875519 GCCTTGGGATGAAGCTGCCTTGG - Intronic
970554164 4:17214851-17214873 CCATAGGGATAGAGCTGCCCAGG - Intergenic
976847654 4:89508690-89508712 GTCTTGGGATAAAGCTGACAGGG + Intergenic
981093679 4:140757333-140757355 GTCTAGGGATAAAGCTGCCCTGG - Intergenic
982304838 4:153920065-153920087 ATCTAGGGGCAAAGTTGCCCCGG + Intergenic
985408367 4:189658502-189658524 GGGCAGGGATAAAACTGCCCTGG + Intergenic
985444555 4:190014990-190015012 GTAGAGGGAGACAGCTGCCCGGG + Intergenic
985538629 5:477717-477739 GTGAAGGGGTAAAGCTGCCTGGG + Intronic
993085421 5:83357801-83357823 GTCTCTTGATAGAGCTGCCCCGG + Intergenic
996884718 5:128341555-128341577 ATCTTGGGATACAGCTGCCCAGG - Intronic
1000051037 5:157563143-157563165 GTCTAGGGACGCAGCTGGCCAGG + Intronic
1001307838 5:170588689-170588711 GCCTTGGGATAAAGCTTCCAGGG - Intronic
1004484117 6:16049525-16049547 TTCTAGTAATAAACCTGCCCTGG - Intergenic
1006424581 6:33956185-33956207 GTCTGGGGCAAAAGGTGCCCAGG - Intergenic
1013073375 6:106749454-106749476 TTCTAAGTATAAACCTGCCCTGG - Intergenic
1018811746 6:167303203-167303225 GTCTAGGAATAAAGCAGGCATGG - Intronic
1019457604 7:1138515-1138537 GTCTGGGGTGCAAGCTGCCCCGG + Intergenic
1019466753 7:1193885-1193907 GTCTGGGGAGACAGCTGCCCTGG - Intergenic
1023743887 7:43304179-43304201 AGCTCTGGATAAAGCTGCCCTGG + Intronic
1024872189 7:53976861-53976883 GTATAGTGATAAAGTTGCCAGGG - Intergenic
1028070718 7:86446875-86446897 CTCAAGGGATCAACCTGCCCTGG - Intergenic
1030498509 7:110329753-110329775 GTCAGTGTATAAAGCTGCCCTGG + Intergenic
1030743711 7:113139729-113139751 GTCTATGCATAAAGGTGGCCAGG - Intergenic
1031928521 7:127661459-127661481 GCCTAGGGATGAAGCTCCTCAGG - Intronic
1032194896 7:129782815-129782837 GACTAGGGGGAAAGGTGCCCGGG + Intergenic
1033865652 7:145687547-145687569 GGGTAGAGATAAAGATGCCCTGG - Intergenic
1042078939 8:65028193-65028215 GTCTAGTGCTAAAGCTGCAATGG + Intergenic
1044819497 8:96145857-96145879 GTCTAGGGGAAACGCGGCCCAGG - Intronic
1046380072 8:113438294-113438316 GCCAAGGGACAAAGCTGGCCAGG - Intergenic
1052825388 9:33170418-33170440 GTCTAGGGGTAAAGTCGGCCTGG + Intergenic
1053749599 9:41237683-41237705 GTAGAGGGAGACAGCTGCCCGGG - Intergenic
1054255045 9:62802564-62802586 GTAGAGGGAGACAGCTGCCCGGG - Intergenic
1054336263 9:63813042-63813064 GTAGAGGGAGACAGCTGCCCGGG + Intergenic
1056839517 9:89987177-89987199 GTCTAGGGATGATACTGTCCTGG - Intergenic
1057025955 9:91733877-91733899 GTCTGGGGAGAAGGCTGTCCCGG + Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1060827197 9:126693956-126693978 GGCTAGGGACAAAGGGGCCCGGG + Intronic
1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG + Intronic
1062077326 9:134597886-134597908 GTCTGGGGAGAAAGCTGACTAGG - Intergenic
1188864966 X:35303599-35303621 GTCTAGGAATACAGCTAGCCAGG + Intergenic
1189909355 X:45794449-45794471 GTCTAAGAGTAAAGCTGGCCAGG + Intergenic
1190159588 X:48021671-48021693 GCCCAGGGATAAAGGGGCCCAGG + Intronic
1193849881 X:86523953-86523975 TTCTGGGGATAAAACTGCCTAGG - Intronic
1193970060 X:88039661-88039683 GCCTGGGGATATACCTGCCCTGG + Intergenic
1194220272 X:91181757-91181779 ATCTAGGAATATAGCTGACCAGG - Intergenic
1196524608 X:116717596-116717618 ATCTAGGAATATAGCTGACCAGG + Intergenic
1200556787 Y:4645509-4645531 ATCTAGGAATATAGCTGACCAGG - Intergenic
1201065848 Y:10093119-10093141 GTAGAGGGAGACAGCTGCCCTGG - Intergenic