ID: 981096774

View in Genome Browser
Species Human (GRCh38)
Location 4:140790034-140790056
Sequence TTCATGCTATTGAAACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981096774_981096780 19 Left 981096774 4:140790034-140790056 CCTGGCAGTTTCAATAGCATGAA No data
Right 981096780 4:140790076-140790098 GGAAAATGAAGCCAAATACGTGG No data
981096774_981096779 -2 Left 981096774 4:140790034-140790056 CCTGGCAGTTTCAATAGCATGAA No data
Right 981096779 4:140790055-140790077 AAGCATGACAATAATGGGGAGGG No data
981096774_981096775 -8 Left 981096774 4:140790034-140790056 CCTGGCAGTTTCAATAGCATGAA No data
Right 981096775 4:140790049-140790071 AGCATGAAGCATGACAATAATGG No data
981096774_981096778 -3 Left 981096774 4:140790034-140790056 CCTGGCAGTTTCAATAGCATGAA No data
Right 981096778 4:140790054-140790076 GAAGCATGACAATAATGGGGAGG No data
981096774_981096776 -7 Left 981096774 4:140790034-140790056 CCTGGCAGTTTCAATAGCATGAA No data
Right 981096776 4:140790050-140790072 GCATGAAGCATGACAATAATGGG No data
981096774_981096777 -6 Left 981096774 4:140790034-140790056 CCTGGCAGTTTCAATAGCATGAA No data
Right 981096777 4:140790051-140790073 CATGAAGCATGACAATAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981096774 Original CRISPR TTCATGCTATTGAAACTGCC AGG (reversed) Intergenic
No off target data available for this crispr