ID: 981096779

View in Genome Browser
Species Human (GRCh38)
Location 4:140790055-140790077
Sequence AAGCATGACAATAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981096774_981096779 -2 Left 981096774 4:140790034-140790056 CCTGGCAGTTTCAATAGCATGAA No data
Right 981096779 4:140790055-140790077 AAGCATGACAATAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981096779 Original CRISPR AAGCATGACAATAATGGGGA GGG Intergenic
No off target data available for this crispr