ID: 981100575

View in Genome Browser
Species Human (GRCh38)
Location 4:140825526-140825548
Sequence AGGAAAACTAACAGACAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9376
Summary {0: 26, 1: 5689, 2: 2357, 3: 602, 4: 702}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981100575_981100578 18 Left 981100575 4:140825526-140825548 CCTTTCTGTCTGTTAGTTTTCCT 0: 26
1: 5689
2: 2357
3: 602
4: 702
Right 981100578 4:140825567-140825589 GTTAGCTGCACCTCAGCTGCAGG No data
981100575_981100579 26 Left 981100575 4:140825526-140825548 CCTTTCTGTCTGTTAGTTTTCCT 0: 26
1: 5689
2: 2357
3: 602
4: 702
Right 981100579 4:140825575-140825597 CACCTCAGCTGCAGGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981100575 Original CRISPR AGGAAAACTAACAGACAGAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr