ID: 981100577

View in Genome Browser
Species Human (GRCh38)
Location 4:140825546-140825568
Sequence ACTGCAACACACCTGTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981100577_981100581 16 Left 981100577 4:140825546-140825568 CCTTCTAACAGGTGTGTTGCAGT No data
Right 981100581 4:140825585-140825607 GCAGGTGTGTTGGAGTTTGCTGG 0: 36
1: 2101
2: 2139
3: 1193
4: 782
981100577_981100579 6 Left 981100577 4:140825546-140825568 CCTTCTAACAGGTGTGTTGCAGT No data
Right 981100579 4:140825575-140825597 CACCTCAGCTGCAGGTGTGTTGG No data
981100577_981100582 19 Left 981100577 4:140825546-140825568 CCTTCTAACAGGTGTGTTGCAGT No data
Right 981100582 4:140825588-140825610 GGTGTGTTGGAGTTTGCTGGCGG 0: 32
1: 2000
2: 2972
3: 1507
4: 1097
981100577_981100578 -2 Left 981100577 4:140825546-140825568 CCTTCTAACAGGTGTGTTGCAGT No data
Right 981100578 4:140825567-140825589 GTTAGCTGCACCTCAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981100577 Original CRISPR ACTGCAACACACCTGTTAGA AGG (reversed) Intergenic
No off target data available for this crispr