ID: 981100578

View in Genome Browser
Species Human (GRCh38)
Location 4:140825567-140825589
Sequence GTTAGCTGCACCTCAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981100577_981100578 -2 Left 981100577 4:140825546-140825568 CCTTCTAACAGGTGTGTTGCAGT No data
Right 981100578 4:140825567-140825589 GTTAGCTGCACCTCAGCTGCAGG No data
981100575_981100578 18 Left 981100575 4:140825526-140825548 CCTTTCTGTCTGTTAGTTTTCCT 0: 26
1: 5689
2: 2357
3: 602
4: 702
Right 981100578 4:140825567-140825589 GTTAGCTGCACCTCAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981100578 Original CRISPR GTTAGCTGCACCTCAGCTGC AGG Intergenic
No off target data available for this crispr