ID: 981100579

View in Genome Browser
Species Human (GRCh38)
Location 4:140825575-140825597
Sequence CACCTCAGCTGCAGGTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981100577_981100579 6 Left 981100577 4:140825546-140825568 CCTTCTAACAGGTGTGTTGCAGT No data
Right 981100579 4:140825575-140825597 CACCTCAGCTGCAGGTGTGTTGG No data
981100575_981100579 26 Left 981100575 4:140825526-140825548 CCTTTCTGTCTGTTAGTTTTCCT 0: 26
1: 5689
2: 2357
3: 602
4: 702
Right 981100579 4:140825575-140825597 CACCTCAGCTGCAGGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981100579 Original CRISPR CACCTCAGCTGCAGGTGTGT TGG Intergenic
No off target data available for this crispr