ID: 981100581

View in Genome Browser
Species Human (GRCh38)
Location 4:140825585-140825607
Sequence GCAGGTGTGTTGGAGTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6251
Summary {0: 36, 1: 2101, 2: 2139, 3: 1193, 4: 782}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981100577_981100581 16 Left 981100577 4:140825546-140825568 CCTTCTAACAGGTGTGTTGCAGT No data
Right 981100581 4:140825585-140825607 GCAGGTGTGTTGGAGTTTGCTGG 0: 36
1: 2101
2: 2139
3: 1193
4: 782

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981100581 Original CRISPR GCAGGTGTGTTGGAGTTTGC TGG Intergenic
Too many off-targets to display for this crispr