ID: 981100582

View in Genome Browser
Species Human (GRCh38)
Location 4:140825588-140825610
Sequence GGTGTGTTGGAGTTTGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7608
Summary {0: 32, 1: 2000, 2: 2972, 3: 1507, 4: 1097}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981100577_981100582 19 Left 981100577 4:140825546-140825568 CCTTCTAACAGGTGTGTTGCAGT No data
Right 981100582 4:140825588-140825610 GGTGTGTTGGAGTTTGCTGGCGG 0: 32
1: 2000
2: 2972
3: 1507
4: 1097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981100582 Original CRISPR GGTGTGTTGGAGTTTGCTGG CGG Intergenic
Too many off-targets to display for this crispr