ID: 981100768

View in Genome Browser
Species Human (GRCh38)
Location 4:140826801-140826823
Sequence GTTTCTAACATATTCAAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981100767_981100768 15 Left 981100767 4:140826763-140826785 CCTGCATACATGGTTTCAGTGTC No data
Right 981100768 4:140826801-140826823 GTTTCTAACATATTCAAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981100768 Original CRISPR GTTTCTAACATATTCAAGCA CGG Intergenic
No off target data available for this crispr