ID: 981102853

View in Genome Browser
Species Human (GRCh38)
Location 4:140849603-140849625
Sequence CCGTGCCTCTCCCTAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981102851_981102853 -5 Left 981102851 4:140849585-140849607 CCTGAAGGAGAATTTGTTCCGTG No data
Right 981102853 4:140849603-140849625 CCGTGCCTCTCCCTAGCTTCTGG No data
981102850_981102853 7 Left 981102850 4:140849573-140849595 CCTTCTGAGGGTCCTGAAGGAGA No data
Right 981102853 4:140849603-140849625 CCGTGCCTCTCCCTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981102853 Original CRISPR CCGTGCCTCTCCCTAGCTTC TGG Intergenic
No off target data available for this crispr