ID: 981103671

View in Genome Browser
Species Human (GRCh38)
Location 4:140857020-140857042
Sequence CAGTGGTAGCCTGTATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981103671_981103677 12 Left 981103671 4:140857020-140857042 CCAGCAGATACAGGCTACCACTG No data
Right 981103677 4:140857055-140857077 GGACGGCACCTTCTTTTGCTAGG No data
981103671_981103678 13 Left 981103671 4:140857020-140857042 CCAGCAGATACAGGCTACCACTG No data
Right 981103678 4:140857056-140857078 GACGGCACCTTCTTTTGCTAGGG No data
981103671_981103674 -9 Left 981103671 4:140857020-140857042 CCAGCAGATACAGGCTACCACTG No data
Right 981103674 4:140857034-140857056 CTACCACTGGTTGGAGATTTAGG No data
981103671_981103676 -5 Left 981103671 4:140857020-140857042 CCAGCAGATACAGGCTACCACTG No data
Right 981103676 4:140857038-140857060 CACTGGTTGGAGATTTAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981103671 Original CRISPR CAGTGGTAGCCTGTATCTGC TGG (reversed) Intergenic
No off target data available for this crispr