ID: 981104626

View in Genome Browser
Species Human (GRCh38)
Location 4:140866433-140866455
Sequence CTTTTCCCACACATAGAGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981104626 Original CRISPR CTTTTCCCACACATAGAGAG TGG Exonic
901453978 1:9352869-9352891 CTGCTCCCACACGTGGAGAGAGG + Intronic
901763123 1:11483434-11483456 TTTTTCCCACACATTAAGTGAGG - Intronic
903071130 1:20727424-20727446 CTCTCCCCACAGTTAGAGAGGGG - Intronic
903311129 1:22457228-22457250 CTTTTCACAGAGATAAAGAGAGG - Intronic
905231215 1:36515914-36515936 CATTTCACAGACCTAGAGAGGGG + Intergenic
905257745 1:36695866-36695888 CTTCTCCAAGACATAGAGATTGG + Intergenic
905298653 1:36971179-36971201 CTTCTCCAAGACATAGAGATGGG + Intronic
905630863 1:39517850-39517872 CTTTGGCCACACACAGATAGAGG - Intronic
906609934 1:47194435-47194457 CTTGCCCCACAGATAGAGAGTGG - Intergenic
910077009 1:83292832-83292854 CTTTTTCAATACATAGATAGAGG + Intergenic
911133054 1:94410454-94410476 CTTTTCCCATTCAGAGAGAAAGG + Intergenic
912162341 1:107000835-107000857 CTTCTCACACTCAGAGAGAGAGG - Intergenic
913217034 1:116629300-116629322 CTTTTTCCACACATATATAGAGG - Intronic
914792103 1:150887195-150887217 CTCTTCCCACAAAAGGAGAGTGG - Intergenic
916564348 1:165960253-165960275 CTCTTCCCACACATATAGGGTGG - Intergenic
920591514 1:207223183-207223205 CTTTTCCTTCACATTGAGAGAGG - Intergenic
922748918 1:228061785-228061807 CTGTCCCCAAACCTAGAGAGGGG - Intergenic
923226103 1:231940178-231940200 TCTTTACCACACACAGAGAGAGG - Intronic
1063052273 10:2465472-2465494 CTTTTCCCACTATTAGAGTGAGG - Intergenic
1063864455 10:10348926-10348948 CATATCCCGCACATAGAGAGTGG + Intergenic
1065685467 10:28280232-28280254 CTTTTCGCCCACATATACAGAGG - Intronic
1065708575 10:28493981-28494003 TTTTTCTCACACAAAGAGAGAGG - Intergenic
1066401755 10:35083599-35083621 CTTTCCCCCCACAAAGAGGGTGG + Intronic
1067815140 10:49468561-49468583 GTTTTCACAGACATAGAGACAGG + Intronic
1073363247 10:102917423-102917445 CTTTTCCCATATTTACAGAGTGG - Intergenic
1073907552 10:108300676-108300698 CTTTTACCACACCCTGAGAGTGG + Intergenic
1078621549 11:12913207-12913229 CTTTACCTGCACATGGAGAGGGG - Intronic
1079537055 11:21527171-21527193 CTTTTGCTACACAAAGAGACTGG - Intronic
1079761978 11:24340312-24340334 TTTTTCCTACACTTAGAAAGAGG + Intergenic
1080813318 11:35727817-35727839 ATTTTCCCACAGATACAGATGGG - Intronic
1084755783 11:71237787-71237809 CTTTTACCAAAGAGAGAGAGAGG - Intronic
1087252603 11:95920185-95920207 CTATCCCCACAGAAAGAGAGAGG - Intronic
1087349218 11:97009949-97009971 ATTTTCTCACACAGAAAGAGGGG - Intergenic
1087485590 11:98756295-98756317 CTTTTCTCACACATAGGAGGAGG + Intergenic
1089333359 11:117705568-117705590 ATTTTCCCACTCATAGCCAGAGG - Intronic
1089620025 11:119716789-119716811 CTTCTCCCACACACAGGTAGGGG - Intronic
1090924357 11:131236415-131236437 CTTTTCCCACACCTGGAAATGGG + Intergenic
1091881350 12:3980910-3980932 TTTTTCCAACACATATTGAGTGG - Intergenic
1093190538 12:16069725-16069747 ATTATCCCAAACATAGAGATGGG + Intergenic
1094204035 12:27821617-27821639 TTTTTCTCCCACATACAGAGAGG - Intergenic
1095214839 12:39536181-39536203 CTTTTCACACATATACACAGAGG + Intergenic
1095276646 12:40292478-40292500 CATTTCACACACATATAAAGTGG + Intronic
1097808868 12:63996067-63996089 CTTTTTTCACATATAGAGATTGG - Intronic
1098441477 12:70523696-70523718 CTTCTCCTACCCATAAAGAGTGG - Intronic
1098611455 12:72463561-72463583 CTCTTCTCACACTTAGAGTGTGG + Intronic
1100700191 12:97139147-97139169 CTTTTCCCAGACAGATAGACTGG + Intergenic
1102939781 12:116929147-116929169 CTTTGGCCACACTTTGAGAGAGG + Intronic
1110388804 13:74947201-74947223 CTATTCCCAAACATAGAGGAAGG + Intergenic
1110611161 13:77489864-77489886 CATTTCCCAAACATAGAGAGTGG - Intergenic
1111445030 13:88335974-88335996 CTTTTCCCACATAAACACAGAGG - Intergenic
1111466883 13:88624754-88624776 CTTTTCTCACACAGAGAAAGGGG + Intergenic
1114717181 14:24839246-24839268 CATTTCCCACACGGAGAGAAAGG + Intronic
1120429001 14:84390000-84390022 CATTTAGCACACATAGAGAATGG + Intergenic
1127347861 15:58118985-58119007 CATTTCCCACACATTAACAGTGG - Intronic
1127489127 15:59445586-59445608 TTTTTCACACACTCAGAGAGAGG - Intronic
1132397064 15:101481879-101481901 TTTTTCCCTCCAATAGAGAGAGG + Intronic
1135765503 16:25174426-25174448 CTTTTTCTTTACATAGAGAGTGG + Intronic
1138957511 16:61989335-61989357 GTTTTCCCACACATGGAGACTGG + Intronic
1144216284 17:13058393-13058415 CTTTTCCCACACCTAGTAATAGG - Intergenic
1144453152 17:15397807-15397829 CTGTTCCCTCACATTCAGAGGGG - Intergenic
1144943762 17:18959433-18959455 CCTTGCCCAGACCTAGAGAGGGG + Intronic
1145011333 17:19369981-19370003 CTTTTCCTGCAGATTGAGAGAGG + Intronic
1147761012 17:42797361-42797383 CTTTTCCCATCCCCAGAGAGAGG - Intronic
1150004426 17:61461281-61461303 CGTTTCACACACATACATAGAGG - Intronic
1150432814 17:65131958-65131980 CTTTTTCCAGACTTTGAGAGGGG + Intergenic
1151399479 17:73846564-73846586 CTTTTTCCAAACATACAGAGGGG - Intergenic
1151527856 17:74683224-74683246 CTACTCCCACCCATAGAGGGAGG - Intronic
1159136953 18:64347786-64347808 CTTTGCCCACAGAGAGAGATAGG + Intergenic
1160313369 18:77818716-77818738 CTCTTCCCACACCTAGAGACAGG + Intergenic
1160492405 18:79349362-79349384 CTTTTCTCACACATGAAGTGGGG - Intronic
1167713975 19:51129025-51129047 CTATTCACAAACATAAAGAGTGG + Intronic
1167880162 19:52451098-52451120 TTTTTCCCACCCATAAAGATGGG + Intronic
1168455656 19:56506416-56506438 CTTTTCCCAGAAGTAGAGGGTGG - Intergenic
926928104 2:18008739-18008761 CCTTTCCCACTAACAGAGAGCGG - Intronic
929179069 2:39013774-39013796 CCTTTCCCAAACAAGGAGAGGGG - Intronic
929360156 2:41078244-41078266 CTTTTCCTACACATAGAAAAAGG - Intergenic
932347371 2:71004457-71004479 TTTTTCCCACAACTGGAGAGTGG + Intergenic
932689091 2:73897231-73897253 TGTTTCCCACACACAGAAAGAGG - Exonic
932928602 2:76006335-76006357 TTTTTCCCACACAAACAAAGGGG - Intergenic
933178063 2:79198092-79198114 CTTTTCATACACATGGAGACTGG + Intronic
934480981 2:94644185-94644207 CTTTTCCCAAAGAAAGAGATGGG + Intergenic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
936594337 2:113833583-113833605 CTTTTCCCACACACAAATAGGGG + Intergenic
938178227 2:129155883-129155905 CTGTACCCACACCTAGAGAGTGG + Intergenic
939077468 2:137621114-137621136 CTTTTCACCCACATAAAGAGAGG + Intronic
944611797 2:201417153-201417175 CTTTTTCCAAACACAGAGAAAGG + Intronic
945233789 2:207615918-207615940 TTTTTCCCAAACATACAGAGAGG + Intronic
946489001 2:220129712-220129734 CTGTTCCCACACAGGGAGGGAGG - Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947990905 2:234486801-234486823 CTTGTCACACACAGAGAGGGTGG + Intergenic
948188381 2:236039432-236039454 CTTTTTCCCCACCTAGAGAGAGG - Intronic
948222300 2:236281045-236281067 CTATTCCAAAAGATAGAGAGAGG + Intergenic
949035946 2:241815792-241815814 CGCTGCCCACACAGAGAGAGCGG - Intronic
1169817461 20:9672798-9672820 CTTTGCCCACATATACAGATAGG + Intronic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1171503649 20:25615125-25615147 CTTTTCCCAGACACACAGTGGGG - Exonic
1172037665 20:32021103-32021125 CTTTCCCCACACAGTCAGAGTGG + Intronic
1173075178 20:39811605-39811627 CTTTCCCCATACATAAAGAAAGG + Intergenic
1173121818 20:40299586-40299608 TTTTTTCCACACTTGGAGAGAGG + Intergenic
1174504081 20:51005368-51005390 CATTTTCCACACATAGCCAGAGG + Intronic
1179157031 21:38859641-38859663 CTTTTCCCTAGCATAGAGTGTGG + Intergenic
1180818390 22:18807691-18807713 CTTTTTCCACACATATATAGAGG - Intergenic
1181204612 22:21242146-21242168 CTTTTTCCACACATATATAGAGG - Intergenic
1181538178 22:23557632-23557654 ATTTTCTCACTCATAGAGCGAGG + Intergenic
1183838902 22:40481146-40481168 CTCTTCCCAGACAGAGAGACAGG + Intronic
1184282688 22:43447280-43447302 CTTTTCACAAACATGGAGAGAGG + Intronic
1185240107 22:49737800-49737822 CCATTCCCACATATACAGAGAGG + Intergenic
1203222312 22_KI270731v1_random:53269-53291 CTTTTTCCACACATATATAGAGG + Intergenic
1203268519 22_KI270734v1_random:33545-33567 CTTTTTCCACACATATATAGAGG - Intergenic
953050509 3:39337898-39337920 CTTTTCTCACAGAGAGAGAGAGG + Intergenic
954914999 3:54141197-54141219 TTTTTCCCCCAAATAGAGAAGGG - Intronic
954964457 3:54597969-54597991 CCTTTCCCATCCATAGAGCGAGG + Intronic
954983781 3:54771158-54771180 CTTTCCAGACACAGAGAGAGGGG + Intronic
956337538 3:68180825-68180847 CCTAGCCCACACAGAGAGAGAGG - Intronic
957332498 3:78783662-78783684 GTTTTCCCATAGGTAGAGAGAGG - Intronic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
958462478 3:94417080-94417102 CATTTCCCAGACAAAGAGAAGGG - Intergenic
962780862 3:138715109-138715131 TCTTTCCTACACATAGAGAAGGG - Intronic
962829085 3:139123839-139123861 CTTTCTCCACGCATACAGAGTGG - Intronic
966743048 3:183251744-183251766 CCTGTCCCACCCAGAGAGAGGGG - Intronic
968239643 3:197065640-197065662 TTTTTCCCACACACAGTGACAGG + Intronic
968680824 4:1918247-1918269 CTGGTCCCCCACATAGAGAAAGG - Exonic
969151818 4:5176201-5176223 CCTTTCCCAGACAAAGAAAGGGG - Intronic
970523336 4:16907550-16907572 CTGTTTCCTCACCTAGAGAGTGG - Intergenic
971598733 4:28567012-28567034 CTTTTCCCACAAAGAGAGACTGG + Intergenic
972596712 4:40535870-40535892 TTTTTCCCCCTCATAGAGATGGG + Intronic
972824095 4:42736649-42736671 ATTTTCCCAGACATGGAGTGAGG + Intergenic
973142017 4:46781488-46781510 CCTTTCCTACACATACTGAGAGG + Intronic
973824549 4:54691941-54691963 CTCTTCCCATACATAGGAAGTGG + Intronic
975916933 4:79336139-79336161 CTTTTCTCCCATAGAGAGAGTGG + Intergenic
976051798 4:81018640-81018662 CTCTTTCCACATATAGAGATAGG - Intergenic
976078898 4:81332111-81332133 CTTTGCGCATACATAGAGAACGG + Intergenic
978742831 4:112157239-112157261 CTTTTTCCACAGGCAGAGAGAGG + Intronic
979171602 4:117607390-117607412 ATTGTCCCACAAACAGAGAGCGG + Intergenic
980190840 4:129522964-129522986 CTTTTCCCACACAAAGTGAAAGG + Intergenic
981104626 4:140866433-140866455 CTTTTCCCACACATAGAGAGTGG + Exonic
983035278 4:162857358-162857380 CTTTTTCCAAAAATAGAGATGGG + Intergenic
985644359 5:1078071-1078093 CTTCTCCCACCCAGAGCGAGGGG + Intronic
985762251 5:1755473-1755495 GTTTGCACACACATAGAGAAAGG - Intergenic
985974153 5:3402004-3402026 CTTTTCCATCACCTAGAGATGGG + Intergenic
988479776 5:31620028-31620050 CTAATCACACACATAGAGGGAGG + Intergenic
989568769 5:42925912-42925934 CTTTTCTCACCCAGAGACAGAGG + Intergenic
989707604 5:44356188-44356210 CTTTTCCCACTGAAAGGGAGTGG + Intronic
989722364 5:44544401-44544423 GTTTTACCAGAAATAGAGAGAGG - Intergenic
990973422 5:61535135-61535157 CTGATGCCACACATTGAGAGAGG + Intronic
991928484 5:71728399-71728421 CTCTTCCCTCACAGAGACAGAGG + Intergenic
992076674 5:73198479-73198501 CTTCTCCCAGACTTAGAGAGGGG - Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
996487657 5:124055867-124055889 CTTGTCCCACACGTACAGATGGG - Intergenic
1000212801 5:159123435-159123457 CTTTTTCCAAAAATAGAGGGGGG - Intergenic
1002798635 6:498905-498927 CTTTGCCAACACTTTGAGAGTGG - Intronic
1009983603 6:70756300-70756322 CTTTTCTCACACAGAGATATAGG + Intronic
1011623100 6:89260998-89261020 CTGTTCTCACACAGACAGAGGGG + Intronic
1015085190 6:129282395-129282417 CAGTTCCCACATATAGAGAAAGG - Intronic
1015298938 6:131631163-131631185 CTTTTCACACACATAGGTACTGG + Intronic
1016599573 6:145842595-145842617 CTTTTCCCACTCAAAAAGTGAGG - Intergenic
1016742193 6:147540756-147540778 GTTTACCCAGACAGAGAGAGAGG + Intronic
1016952984 6:149599222-149599244 CTTTTTCAACAAATGGAGAGAGG + Intronic
1017804360 6:157930721-157930743 ATTTTTCCACAGATAGACAGTGG - Intronic
1017888777 6:158622321-158622343 CTTATCCCACACACAGGGACTGG - Intronic
1018193937 6:161338153-161338175 CTTTTCCCACTCATTAAAAGTGG + Intergenic
1020584202 7:10045496-10045518 CGTTTCCCACACTTAAGGAGTGG + Intergenic
1022209895 7:28198076-28198098 CTGTGCCCTCACATAGAGATAGG - Intergenic
1022668249 7:32431003-32431025 CTTTTCCTAAACATAGGGATAGG - Intergenic
1023001812 7:35815921-35815943 ACTTTCCCACACATCGATAGAGG + Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1036267049 8:7278930-7278952 CTTCTCCCACACGTGGAGACGGG - Intergenic
1036354298 8:8031463-8031485 CTTCTCCCACACGTGGAGACGGG + Intergenic
1038013466 8:23493716-23493738 CTGTTCCCATACACAGAGACAGG + Intergenic
1039315464 8:36367093-36367115 CTTTTGCTACACACAGAGAAAGG + Intergenic
1040902658 8:52432682-52432704 TTTTTTCCACACATAGAAATAGG - Intronic
1042815307 8:72872032-72872054 CTTTTCTCAGCCTTAGAGAGTGG + Intronic
1044914868 8:97102353-97102375 CTTTTTCCAGAAGTAGAGAGAGG + Intronic
1047483142 8:125303576-125303598 CTTTTCCTAAACAGCGAGAGGGG - Intronic
1049556428 8:143284682-143284704 CTATTCCCCCACAGCGAGAGGGG + Intergenic
1052597749 9:30582300-30582322 ATTTTTCCACACACAGAGGGTGG + Intergenic
1052749634 9:32476497-32476519 TTTTTCCCCCACTTAGAGACGGG - Intronic
1053676857 9:40439784-40439806 CTTTTCCCAAAGAGAGAGATGGG - Intergenic
1053926620 9:43065881-43065903 CTTTTCCCAAAGAAAGAGATGGG - Intergenic
1054286862 9:63185123-63185145 CTTTTCCCAAAGAGAGAGATGGG + Intergenic
1054289924 9:63275311-63275333 CTTTTCCCAAAGAGAGAGATGGG - Intergenic
1054387955 9:64579851-64579873 CTTTTCCCAAAGAGAGAGATGGG - Intergenic
1054507765 9:65936518-65936540 CTTTTCCCAAAGAGAGAGATGGG + Intergenic
1055783538 9:79846067-79846089 AATTTCCCACAAATATAGAGTGG + Intergenic
1055838577 9:80475135-80475157 CTTTTTCCAGCCATATAGAGTGG + Intergenic
1057389033 9:94627753-94627775 CTTTTCCCATCCCTAGAGAATGG - Intronic
1058538862 9:105991408-105991430 CTATTTCCACCCATGGAGAGGGG - Intergenic
1058680451 9:107436119-107436141 GTTTTCACTCACTTAGAGAGTGG - Intergenic
1061854880 9:133436637-133436659 GTTTTCCCATCAATAGAGAGAGG + Intronic
1189029195 X:37432449-37432471 CATTTCCCACCCACAGAGACAGG + Intronic
1192267061 X:69546290-69546312 CTTTTCCACCACTTAGAAAGAGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1194605153 X:95970629-95970651 CTCTTGCCACACATACAAAGTGG - Intergenic
1194923560 X:99796350-99796372 CTCTTCCTGCACATAGACAGTGG - Intergenic
1196321428 X:114344920-114344942 CTCTTCCCCCAACTAGAGAGAGG + Intergenic
1197917415 X:131551339-131551361 ATTTTCCCAGGCATAGAAAGTGG - Intergenic
1201067585 Y:10112846-10112868 CTTTTCCCAGTCAAAGAAAGTGG - Intergenic
1201727701 Y:17171531-17171553 CTCTTCCCACACATTCTGAGAGG - Intergenic