ID: 981107743

View in Genome Browser
Species Human (GRCh38)
Location 4:140900367-140900389
Sequence GGTGATGCTGATAACCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981107741_981107743 2 Left 981107741 4:140900342-140900364 CCAATTTACTGATGGGCTGACTA 0: 1
1: 0
2: 1
3: 7
4: 140
Right 981107743 4:140900367-140900389 GGTGATGCTGATAACCTCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981107743 Original CRISPR GGTGATGCTGATAACCTCAG AGG Intronic
903374298 1:22856183-22856205 GGTGATCCTCAAAACCTCAATGG - Intronic
906976330 1:50577030-50577052 CATGATGCTGATAAAATCAGTGG - Intronic
912225476 1:107728501-107728523 GGTGTTGCTCATGACCTCTGTGG + Intronic
913079080 1:115365033-115365055 GGTGAAGCTGCTAAGCTGAGAGG - Intergenic
913198156 1:116475083-116475105 ACTGATGATGATAATCTCAGTGG - Intergenic
921857933 1:220008804-220008826 GTTCATGCTTATAATCTCAGAGG - Intronic
923790613 1:237108041-237108063 GGTGGTGCTGGAAACCTCTGTGG + Intronic
1062812048 10:474256-474278 GCTGATGTTGATGACCACAGTGG - Intronic
1069362455 10:67658106-67658128 GCTGATGCTGATAATCACTGAGG - Intronic
1070650279 10:78230396-78230418 GGTGATGGTGATAACAGCTGTGG - Intergenic
1072997862 10:100262217-100262239 GGTGTTGGTGAGACCCTCAGTGG - Intronic
1074201594 10:111241228-111241250 GGTGATGCTGATAAATTCTTGGG + Intergenic
1081280025 11:41197957-41197979 GGTGATGGTGATAACAACAGGGG - Intronic
1084041032 11:66542877-66542899 GAAGATTCTGATAACCCCAGTGG + Intronic
1085681037 11:78575033-78575055 GGTGAGGCTGAGAAACTGAGAGG + Intergenic
1089151695 11:116369327-116369349 GGGGAAGCTGATAACCACTGTGG - Intergenic
1090548793 11:127795712-127795734 GCTGATGCTGGTACCTTCAGAGG - Intergenic
1090876609 11:130794583-130794605 AGTGATGCTTATTGCCTCAGCGG + Intergenic
1092046908 12:5437802-5437824 GGTGCTGCTGATAAGGTCTGTGG + Intronic
1093038861 12:14356892-14356914 GGTGATTCTGATATCATTAGAGG - Intergenic
1097055621 12:56247515-56247537 GCTGATGCTGCTGACCTCCGGGG - Exonic
1097722660 12:63040438-63040460 GGTGGTGCTGATGACCCCAAGGG - Intergenic
1103204693 12:119119413-119119435 CCTGATGATGATAAGCTCAGAGG + Intronic
1112446491 13:99469299-99469321 GGTGATGCTGAGAAAACCAGCGG - Intergenic
1114734333 14:25028155-25028177 GGTGTAGCTGATAACCTTAATGG - Intronic
1116099921 14:40420789-40420811 GGTGATGCTACAAATCTCAGAGG - Intergenic
1116681983 14:47983891-47983913 GGTGAAGCTGAAGACCTCAGAGG + Intergenic
1121212215 14:92215838-92215860 CGTGATGCTGCTGACCTCATGGG + Intergenic
1121483496 14:94295875-94295897 GGTGATCCAGATAAACTCATAGG + Intergenic
1122440828 14:101730784-101730806 GGTGATGCTGAGAGCCCCTGGGG + Intronic
1123019135 14:105389482-105389504 GGTGCTGCTGATTACCAGAGAGG + Intronic
1132932525 16:2466196-2466218 GATGGTGGTGATGACCTCAGGGG + Intergenic
1135752950 16:25071418-25071440 GGTGATGGTGACAACCTGGGGGG + Intergenic
1137869669 16:51937872-51937894 GGTGATGGTGAGAAAGTCAGTGG + Intergenic
1139968796 16:70761090-70761112 GGTAATACAGAAAACCTCAGAGG + Intronic
1144555660 17:16280570-16280592 GGGGATGCTGATAACCAGAGAGG - Intronic
1146387654 17:32391707-32391729 AGTGATACTCATAACTTCAGAGG + Intergenic
1148480512 17:47956991-47957013 GGTGAAGCTGGCATCCTCAGGGG - Intronic
1153341297 18:3977781-3977803 GGTGATGCTGTTAAAGTCAGAGG + Intronic
1157733912 18:50029751-50029773 GAAGATGCTGAGAACCACAGAGG + Intronic
1160243406 18:77138389-77138411 AGTGTCGCTGATACCCTCAGGGG - Intergenic
1161842699 19:6692582-6692604 GGTGATTCTTATAACATCATGGG + Intronic
1168271795 19:55254075-55254097 GGTGATGGTGCTAAACACAGAGG + Intronic
928251132 2:29681710-29681732 GGTGAAAGTGATAATCTCAGAGG - Intronic
929021169 2:37554794-37554816 GATGATGCTGATGATTTCAGAGG - Intergenic
932847061 2:75146633-75146655 TGTGATGCTAATAACCATAGAGG + Intronic
933886589 2:86723426-86723448 AATGATTCTGATAACCTGAGAGG + Intronic
933923591 2:87073279-87073301 AATGATTCTGATAACCTGAGAGG - Intergenic
938765900 2:134460295-134460317 GGTGATGGTGACAAGCCCAGTGG - Intronic
942556378 2:177176087-177176109 GGGGATGCTAATAACCTCCATGG - Intergenic
942622017 2:177854843-177854865 AGTGATCCAGATAACCTTAGAGG - Intronic
942743688 2:179207510-179207532 GCAGGTGCTGATAACCACAGAGG + Intronic
943435198 2:187856921-187856943 GGTGATGCTGGTTACCTAAGTGG - Intergenic
944419101 2:199509736-199509758 GTGGATGCTGAGAACCACAGAGG - Intergenic
945697280 2:213123081-213123103 AGTGTTGCTAATATCCTCAGAGG + Intronic
1173158034 20:40631431-40631453 GGTGATGGTGAAACCTTCAGGGG + Intergenic
1173513883 20:43651218-43651240 AGTGATGCTGGTGACCTCTGAGG + Intergenic
1178385029 21:32142110-32142132 GGTGGGGCTGAGAACCTCTGTGG - Intergenic
1179721051 21:43316231-43316253 GCAGATGGTGAAAACCTCAGTGG - Intergenic
1182474173 22:30567211-30567233 TGTGATGGTGATGACCTCTGGGG - Intronic
1182585092 22:31340398-31340420 GGGGATGCTGAAAACATAAGAGG - Intronic
1184097292 22:42323412-42323434 TGTGATGCTAATGACCTCTGAGG - Intronic
1184975718 22:48060292-48060314 GGTGAAGCTGCTTTCCTCAGGGG + Intergenic
1185261574 22:49868177-49868199 GTTGTTGTTGATAACATCAGAGG + Intronic
949570331 3:5285952-5285974 GAAGATGTTGAGAACCTCAGTGG + Intergenic
949878760 3:8645252-8645274 GGTGATGCTCAAGATCTCAGAGG - Intronic
951698675 3:25472256-25472278 GATGATGCTAAGAACCTAAGAGG - Intronic
952416013 3:33092274-33092296 GGTGATCCTGATAGAATCAGAGG + Exonic
953478187 3:43224073-43224095 GTGGATGCTGAAAACCTTAGGGG + Intergenic
953658321 3:44871615-44871637 GGGGATGCTGATGGCCCCAGTGG + Intronic
955788256 3:62562452-62562474 GGGGATGATGATAACATCTGTGG + Intronic
956696584 3:71923712-71923734 GGGGATGATGACAACCTCATAGG - Intergenic
957375593 3:79353596-79353618 GGTGCTGGGGATAAACTCAGAGG + Intronic
959624041 3:108429620-108429642 GGTGATGATAATAACATCAGTGG - Intronic
960045186 3:113190370-113190392 GGTGAAGCTCAAGACCTCAGGGG - Intergenic
961593127 3:127995796-127995818 GGTGAGGCTGATGACCTCCCAGG - Intergenic
964155707 3:153582643-153582665 GGTGATGTTGATAATCTGGGAGG - Intergenic
970313074 4:14802982-14803004 GCTGATGATGAGAACCACAGTGG - Intergenic
972689034 4:41378671-41378693 GGTGATGATGGCAACATCAGTGG + Intronic
972772507 4:42210656-42210678 GGTGATGCTTAAAGCCTCAAAGG - Intergenic
976548074 4:86360453-86360475 AGAGATGGTAATAACCTCAGAGG + Intronic
977018716 4:91731209-91731231 GGTGATGCTGGGAAACTGAGAGG - Intergenic
981107743 4:140900367-140900389 GGTGATGCTGATAACCTCAGAGG + Intronic
982408538 4:155046544-155046566 AGTAATGCTGAGAAGCTCAGTGG + Intergenic
985032011 4:185798883-185798905 GGTGATGCTGTTAACCAAAATGG - Intronic
986122016 5:4848242-4848264 GGAGAGGCTGATAAACTCAAAGG - Intergenic
987885068 5:23801981-23802003 GGGGATACAGATATCCTCAGAGG + Intergenic
989138237 5:38176467-38176489 GGTGCTTCTGAGGACCTCAGAGG - Intergenic
990015920 5:51063236-51063258 GATGATGCTGGTAAATTCAGGGG - Intergenic
992061009 5:73047632-73047654 AGTGATTCTGGTATCCTCAGGGG - Intronic
993700228 5:91110359-91110381 AGAGATGCTTCTAACCTCAGTGG - Intronic
995164563 5:109024232-109024254 GAGGATTCTGATAAACTCAGTGG + Intronic
999602182 5:153279513-153279535 GGTGATGCTGATAACGCTAGTGG - Intergenic
1000048224 5:157539195-157539217 GTTGATGGTGATTATCTCAGGGG + Intronic
1003544453 6:7047233-7047255 GATCTTGCTTATAACCTCAGTGG + Intergenic
1006248866 6:32763395-32763417 GGTGATGCTGAGCACCCCAGTGG - Exonic
1013481708 6:110558527-110558549 AGTGATTCTGATATGCTCAGAGG + Intergenic
1019033228 6:169031558-169031580 GGTGATGCTGAGGAAGTCAGAGG - Intergenic
1021158891 7:17247075-17247097 GCTGATGCTAATAGACTCAGAGG - Intergenic
1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG + Intergenic
1028661839 7:93286483-93286505 GGTGAAGCTGAGAACCAGAGTGG + Intronic
1033304580 7:140215076-140215098 GGTGCTGCTTAGAACCCCAGTGG - Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035923297 8:3701443-3701465 GGTTATGGTGCTAAACTCAGAGG + Intronic
1036613166 8:10367431-10367453 GTGGATGCTCAAAACCTCAGAGG - Intronic
1037645204 8:20786907-20786929 GGTAATGGTGATATCCTCAAGGG - Intergenic
1038992976 8:32889721-32889743 GGTGAGGCTGATGACCCGAGTGG - Intergenic
1043856237 8:85268646-85268668 GTTGATACTGATTCCCTCAGAGG + Intronic
1044359900 8:91270813-91270835 GATGATGCTGGTAAATTCAGGGG - Intronic
1053426477 9:38013656-38013678 GGTGCTGCTGAAGACCTCAAAGG - Intronic
1054951249 9:70854374-70854396 GGTGATCCTGACGACCTCACAGG + Intronic
1056769125 9:89464357-89464379 GGTGGGGCTGAGGACCTCAGGGG + Intronic
1058190675 9:101911339-101911361 GTTAATGTTGCTAACCTCAGGGG + Intergenic
1058654146 9:107204406-107204428 GGTGCTGCTGAAAATCTCATAGG + Intergenic
1059319910 9:113461526-113461548 GGTGAAGGTGATACCATCAGAGG + Intronic
1059343965 9:113615860-113615882 GGGGATGCTGGTTACCTCATTGG + Intergenic
1060169202 9:121447128-121447150 GGTGATGTTGAGAACCTGAATGG + Intergenic
1191735056 X:64380165-64380187 GGTGTTTGTAATAACCTCAGTGG - Intronic