ID: 981107966

View in Genome Browser
Species Human (GRCh38)
Location 4:140902968-140902990
Sequence CAGTGGTGCTAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981107964_981107966 -7 Left 981107964 4:140902952-140902974 CCTTGCTAGGTTGGCTCAGTGGT 0: 1
1: 0
2: 3
3: 3
4: 139
Right 981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG 0: 1
1: 0
2: 0
3: 29
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981107966 Original CRISPR CAGTGGTGCTAGAAGGAGAA AGG Intronic
901132253 1:6969325-6969347 GAGTGGAGCTAGAAGGGGCAAGG + Intronic
902056748 1:13606993-13607015 CAGAAGTGCTGCAAGGAGAATGG + Intronic
902177285 1:14660116-14660138 CAGTGGGGCTGGGAGGGGAAGGG + Intronic
902396203 1:16133599-16133621 CAGTTGTTCTGGAAGGAGAAGGG + Exonic
903086129 1:20861095-20861117 GACTGTTGCTAGAAAGAGAAGGG - Intronic
903705802 1:25284845-25284867 CACTGGTGCTAGACAGAGAGGGG - Intronic
903721435 1:25408575-25408597 CACTGGTGCTAGACAGAGAGGGG + Intronic
904274637 1:29372327-29372349 CAGTTGTGATGGAAGGAGACTGG + Intergenic
905561037 1:38927488-38927510 CAGTGATGGTAGAATGATAATGG - Intronic
906224005 1:44106147-44106169 GAGTGGTGATGGAAGGAGAGTGG - Intergenic
906714263 1:47955303-47955325 GAGAGGTGGTGGAAGGAGAAAGG - Intronic
906722664 1:48020346-48020368 CAGTGGTGCTCCAAGCAGAAAGG - Intergenic
906750332 1:48252868-48252890 CAATGGTGGTAGAAGGTCAAGGG - Intergenic
907749382 1:57247386-57247408 CAGTCATGGCAGAAGGAGAAGGG - Intronic
909700386 1:78514862-78514884 GAGGGGAGCAAGAAGGAGAAGGG - Intronic
910266136 1:85339836-85339858 CAGTTGAGCTGGAAGGAGGAGGG - Intronic
911949096 1:104149313-104149335 CAGTGGAGCTTGCAGTAGAAAGG - Intergenic
912560115 1:110545078-110545100 AGCTGGTGCAAGAAGGAGAAAGG - Intergenic
914239907 1:145846401-145846423 CAGTGGGGCCAGTAGGTGAATGG - Intronic
915103804 1:153519746-153519768 CACTGATGCTAGATGGAGGAAGG + Intergenic
915143510 1:153780963-153780985 GAGAGGGGCTAGAAGGGGAAAGG - Intergenic
915557250 1:156667582-156667604 CAGAGGTGCTAGATGGAGACAGG + Intergenic
915746307 1:158161722-158161744 CAGCAGAGCTAGAAAGAGAAAGG + Intergenic
916518595 1:165543541-165543563 CAGTGTTGCCAGAAGAAGATGGG - Intergenic
916546584 1:165811479-165811501 CAGTGGTCCTGGGAGGAAAAGGG - Intronic
917740105 1:177953549-177953571 TAGGGGTGCTGGATGGAGAAGGG - Intronic
919131887 1:193461557-193461579 CTTAGGTGCTAGAAAGAGAAAGG - Intergenic
920040153 1:203090283-203090305 TAGAGGAGCAAGAAGGAGAAGGG + Intergenic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
922332081 1:224586306-224586328 CAGTCATGGTAGAAGGTGAAAGG + Intronic
922609176 1:226911698-226911720 CACTTGTAATAGAAGGAGAATGG - Intronic
922672191 1:227518968-227518990 CAGTGGGGCTAGAGGGAGCCTGG + Intergenic
922708788 1:227810294-227810316 CAGTCATGGTAGAAGGTGAAGGG - Intergenic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
924431260 1:243998626-243998648 CAGTGGTGCTGGATTAAGAAGGG - Intergenic
1062792540 10:318126-318148 CAGTGATGCTGGATGGCGAAAGG + Intronic
1064360621 10:14661088-14661110 CAGTTGTGGCAGAAGGTGAAGGG - Intronic
1064848507 10:19683570-19683592 CTGTGATGCTGGAAAGAGAAAGG - Intronic
1065609972 10:27463283-27463305 CAATTGTGGTAGAAGGTGAAGGG + Intergenic
1065724963 10:28660554-28660576 CAGTAGAGCTTGAAGGAGCAAGG + Intergenic
1065778387 10:29143593-29143615 CAGGGGATCTGGAAGGAGAATGG - Intergenic
1065996529 10:31064390-31064412 GAGTGGTGGTAGAAGGTGGAGGG - Intergenic
1067218505 10:44323709-44323731 CAGTGGTGGTGGAAGGAAAGAGG + Intergenic
1069928179 10:71865600-71865622 CAGTGCTGGTAGCAGGACAAGGG + Intergenic
1070432825 10:76358373-76358395 CAGTGGTGCTCCAAGAACAAAGG - Intronic
1070671124 10:78377898-78377920 TAGTGGTGCACGAAGGAGTAAGG + Intergenic
1073806365 10:107103029-107103051 CAGGAGTGTTGGAAGGAGAAAGG - Intronic
1073931650 10:108583697-108583719 CAGTGATGCTATAAAGATAATGG + Intergenic
1075217658 10:120552478-120552500 CAATGGTGATAGAATGAGAATGG - Intronic
1076186408 10:128453040-128453062 CAGTGGTGATGGAAAAAGAATGG + Intergenic
1078389002 11:10918859-10918881 CAGTCATGGTAGAAGGTGAATGG + Intergenic
1079082970 11:17427090-17427112 CAGTGCGGCTAGAAGGAGCGAGG + Exonic
1079446503 11:20561575-20561597 CAGGGTTGCTAGAGGGAGACTGG + Intergenic
1079688999 11:23399383-23399405 CAGTGGTGGCAGAGTGAGAATGG + Intergenic
1079881456 11:25932508-25932530 CAGTGGTGGTGGGAGGTGAAAGG - Intergenic
1081493195 11:43582452-43582474 CAGTGTTCCTAGCAGGCGAAGGG - Intronic
1081741391 11:45443411-45443433 CCGTGCTGCCAGCAGGAGAAAGG + Intergenic
1082288211 11:50339407-50339429 CAGTCGTGGCAGAAGGTGAAGGG + Intergenic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1082780154 11:57281213-57281235 CAATCGTGGTAGAAGGTGAAGGG + Intergenic
1084041289 11:66544146-66544168 CTGTAGTGCTAGAACTAGAAGGG - Intronic
1084296936 11:68218370-68218392 CAGGGTTGCTACAAGGATAAAGG + Intergenic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1086109078 11:83179165-83179187 CAGTGTTGGGTGAAGGAGAAAGG - Intronic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1089167055 11:116485439-116485461 CACTGATGCTACAAGGTGAAAGG - Intergenic
1089667558 11:120030065-120030087 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
1090138978 11:124233515-124233537 CTGTGGTGCTAGAAGGTCAGAGG - Intergenic
1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG + Intronic
1091108656 11:132944668-132944690 CAGTGGTGCTGGGAGGTGACTGG + Intronic
1091940686 12:4477800-4477822 CAATGGTGGTAGAGGGATAAAGG + Intergenic
1091957772 12:4661972-4661994 CAGTGGTGGTGGAAGTAGAAAGG + Intronic
1092902142 12:13069928-13069950 CACTGGTGCTGGCAGGATAACGG + Intronic
1094397189 12:30020577-30020599 CAGTGATGGTGGAAGGTGAAGGG + Intergenic
1095728228 12:45475136-45475158 CAATGGTGGTAGAAGGCAAAGGG - Intergenic
1095782163 12:46072130-46072152 CAGGAGTGCTAGCAGGGGAAGGG + Intergenic
1096566978 12:52490242-52490264 CAGTGGTGCCATAATGAGGATGG - Intronic
1097699600 12:62806691-62806713 CAGTCGTGGTGGAAGGTGAAGGG - Intronic
1099639017 12:85260606-85260628 CGGTGGAGGTAGAGGGAGAAGGG - Intronic
1099740160 12:86624646-86624668 CAGTGGAGGAAGAAGGGGAAGGG + Intronic
1099947520 12:89261474-89261496 CTGGGGTGATAGAAGGGGAAAGG + Intergenic
1100321677 12:93499489-93499511 TAGTGGTTCTAGAAGGAGTTTGG - Intronic
1101510603 12:105389392-105389414 TAGGGGTGCTAGAAGGAGTGGGG - Intronic
1101624540 12:106426110-106426132 CAGTGCTGCTGGCAGGAGGAGGG - Intronic
1102927229 12:116835614-116835636 CTGGAGTGCTAGATGGAGAAGGG + Intronic
1104181957 12:126390440-126390462 CAGTCATGGTGGAAGGAGAAAGG + Intergenic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1107048367 13:36019358-36019380 ATTTGGGGCTAGAAGGAGAAAGG - Intronic
1107328720 13:39273812-39273834 CATGGATGCTAGAAGAAGAAAGG - Intergenic
1107761882 13:43688250-43688272 CTGTGGTGCCATATGGAGAATGG + Intronic
1107846959 13:44524905-44524927 CTGTGCTTCTGGAAGGAGAAAGG + Intronic
1108277665 13:48827414-48827436 CAGTCATGGTGGAAGGAGAAGGG + Intergenic
1108623993 13:52210016-52210038 CATTGCTTCTGGAAGGAGAAAGG - Intergenic
1108662064 13:52596407-52596429 CATTGCTTCTGGAAGGAGAAAGG + Intergenic
1108931822 13:55834367-55834389 CAGAGGTCATAGAAAGAGAAAGG + Intergenic
1109341363 13:61064672-61064694 CAGTTATGGCAGAAGGAGAAGGG + Intergenic
1110018294 13:70436851-70436873 TAGTTGTGGTAGAAGGTGAAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112206225 13:97325883-97325905 CAGTGGTGCTTGAAAGAAGAGGG + Intronic
1112597723 13:100824054-100824076 AAGTGGTGATGGAAAGAGAATGG - Intergenic
1113701242 13:112390172-112390194 CAGTGGTGCAAGAGGGCTAACGG + Intronic
1114562307 14:23602233-23602255 CAGTAGTGGTTGAAGGTGAAGGG - Intergenic
1114669375 14:24400593-24400615 CAGAGGTGCTAGGAGGGGGAAGG + Intronic
1114751845 14:25213122-25213144 CAGTGCTGCTTGAATGAGGAAGG - Intergenic
1115097487 14:29654803-29654825 CAGTTGTGCAAGTAGCAGAATGG - Intronic
1115821860 14:37221567-37221589 CAGTTATGGTAGAAGGTGAAGGG + Intronic
1115875266 14:37854159-37854181 CAGTCATGCTGGAAGGTGAAGGG - Intronic
1116444358 14:44991327-44991349 CAGTGCTGACAGAAGGAGACTGG - Intronic
1117351023 14:54882155-54882177 CAGTGGTTCAAGATGTAGAATGG + Intronic
1118318429 14:64739303-64739325 CAATGGCTCTAGAAGGAAAAGGG + Intronic
1121105788 14:91278719-91278741 CAGTGCTGCTCGGGGGAGAAGGG + Intronic
1121657473 14:95607755-95607777 CACTCATGCTAGGAGGAGAAAGG + Intergenic
1123585648 15:21758841-21758863 CAGTAGTGTTAGAAAGAGAGTGG - Intergenic
1123622290 15:22201429-22201451 CAGTAGTGTTAGAAAGAGAGTGG - Intergenic
1124579395 15:30939782-30939804 CTGTGGTGTTATAAGGAGATTGG + Exonic
1124787850 15:32698674-32698696 CAGAGTGGCTGGAAGGAGAAGGG + Intergenic
1124999232 15:34754181-34754203 CAGTGGTGCTTGATGGGGAAGGG + Intronic
1125317991 15:38452955-38452977 CAGTTGTGGCAGAAGGGGAAGGG - Intergenic
1126161754 15:45620239-45620261 GAGTGGGGCTAGAACGAGAAAGG - Intronic
1126872304 15:53002611-53002633 AAGTGGTACCAGAAGGAGAGTGG - Intergenic
1127197527 15:56605637-56605659 CAATGGTGGTGGAAGGTGAAGGG + Intergenic
1128781887 15:70364156-70364178 CACTCATGGTAGAAGGAGAAAGG + Intergenic
1129393380 15:75231721-75231743 CAGGGGTGGGAGAGGGAGAAGGG - Intergenic
1130058920 15:80555586-80555608 CAGTGGTGATAGAATGAGCCTGG + Intronic
1130586863 15:85189948-85189970 CAGCAGTGCTAGCAGGAGGAGGG + Intergenic
1130735929 15:86548909-86548931 CAATCGTGGTAGAAGGTGAAGGG + Intronic
1130822164 15:87507263-87507285 CAGTAGTGGTGGAAGGTGAAGGG + Intergenic
1131723298 15:95195319-95195341 CAGTTGTTAAAGAAGGAGAAGGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1134368660 16:13603307-13603329 CAGAGCTCCCAGAAGGAGAAAGG - Intergenic
1135320264 16:21491065-21491087 TAGTGGTGGGAGAAGGAAAAAGG - Intergenic
1135373099 16:21922555-21922577 TAGTGGTGGGAGAAGGAAAAAGG - Intergenic
1135481890 16:22827488-22827510 CAGTGGTGGTGGAGAGAGAAAGG + Intronic
1135918666 16:26628275-26628297 CATTGATGCATGAAGGAGAAAGG - Intergenic
1140452705 16:75083858-75083880 CAGGAGTACTAGAAAGAGAAAGG + Intronic
1140781818 16:78303849-78303871 CAGTGGTGGGAGAAAGAGCACGG - Intronic
1140805962 16:78532661-78532683 CAGTGATGGCAGAAGGTGAAAGG + Intronic
1140906812 16:79416049-79416071 CAGTGCTGCTGGTAGGAGACAGG - Intergenic
1141006705 16:80359338-80359360 CATTGGGGCTGGAAGTAGAAAGG + Intergenic
1141224502 16:82102169-82102191 CAGTGCTGCCAGCAGGAAAATGG + Intergenic
1141814954 16:86403561-86403583 CAGTGGTGGTGGAAGGCAAAAGG + Intergenic
1144010207 17:11140750-11140772 AAGAGGTACAAGAAGGAGAAAGG - Intergenic
1144159743 17:12546098-12546120 AGGTGGTGCTAGAGAGAGAATGG + Intergenic
1145029608 17:19494904-19494926 CAGAGGCTCTAGAAGGAGCAGGG + Intergenic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1147854876 17:43472088-43472110 CAATAGTTCTAGAAGCAGAATGG + Intergenic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1148330005 17:46808481-46808503 GAATGGTGGTAGAAGGAAAAAGG + Intronic
1148886149 17:50774438-50774460 AGGTGGTGCTAGCAGGTGAAGGG - Intergenic
1149067446 17:52497064-52497086 CACAGGTGGTAGAATGAGAATGG - Intergenic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1151193737 17:72416919-72416941 AAGTGGACCTAGAAGGAGAAAGG - Intergenic
1151522807 17:74642505-74642527 GGGTGGTGCCAGCAGGAGAAAGG - Intergenic
1151616103 17:75213133-75213155 CAGTGGTGCTAAAACAATAAAGG - Intronic
1151727746 17:75894439-75894461 CAGGGGTGCCAGGAAGAGAACGG - Intronic
1152518306 17:80838879-80838901 CAGGGGTGCTGGAAGGACAAAGG + Intronic
1153748236 18:8202347-8202369 AAGTGGTGCTAGAAAGAAGAGGG + Intronic
1155141990 18:23052061-23052083 CAGTGGTGGGAGAAGGTTAATGG + Intergenic
1155942990 18:31818517-31818539 CAGTCGTGGTGGAAGGTGAAGGG + Intergenic
1156569345 18:38235262-38235284 GAGAGGTGCTAGAAGGAGTAAGG - Intergenic
1157630726 18:49092774-49092796 GAAGGGTGGTAGAAGGAGAAGGG + Intronic
1158748387 18:60227993-60228015 CAGTCGTGGCAGAAGGTGAAGGG + Intergenic
1161139891 19:2641061-2641083 CAGAGGTGGTACAAGAAGAAGGG + Intronic
1161783565 19:6309638-6309660 CAGGGGTGCTAGGAGGGGGATGG + Intronic
1161821026 19:6531442-6531464 CCTCGGTGCTAGATGGAGAATGG - Intronic
1162240850 19:9352973-9352995 CAGTGGTCCAAGATAGAGAAGGG + Intronic
1163117656 19:15197961-15197983 CAGGGGTAATAGAAGGGGAAGGG + Intronic
1163569099 19:18069706-18069728 CACTGGTTCTGGAAGGAGAGGGG + Exonic
1166297706 19:41897064-41897086 CAGGGGGGCTTGAAAGAGAAGGG - Intronic
1168140497 19:54383543-54383565 TTGTGGAGCTGGAAGGAGAAAGG + Intergenic
1168294592 19:55372672-55372694 CAGTGGTGCTGGATTGGGAAGGG - Intergenic
925264250 2:2553748-2553770 CAGTCATGGTAGAAGGTGAAGGG + Intergenic
925319975 2:2957467-2957489 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
925529111 2:4839941-4839963 CAGAGGGGCAAGAAGGACAAAGG + Intergenic
926360170 2:12079478-12079500 GAGTGGAGCTAGATGGAGAGTGG - Intergenic
927523122 2:23713319-23713341 CAGTGGTGATAGAAAGTGACTGG - Intergenic
927809921 2:26175186-26175208 AAGTTGTGCCTGAAGGAGAAAGG + Intronic
928813106 2:35253641-35253663 AAGGGGAGCTGGAAGGAGAATGG - Intergenic
929052402 2:37849211-37849233 AAGTGGGGGAAGAAGGAGAAGGG - Intergenic
929247853 2:39722027-39722049 CACTGCTGCTGGATGGAGAATGG + Intergenic
929258694 2:39841028-39841050 CAGTGCTGGTAGAAGTAGAAAGG - Intergenic
929309727 2:40408456-40408478 CTGTGGTTTTAGGAGGAGAATGG - Intronic
930328187 2:49946989-49947011 TAGTTGTGCCAAAAGGAGAATGG - Intronic
931147996 2:59541055-59541077 CAGTTGTGGCAGAAGGGGAAGGG - Intergenic
933044220 2:77514584-77514606 CAGTGCTGCTATTAGGAAAATGG - Intronic
933166808 2:79085596-79085618 CGGCGGTTCTAGATGGAGAAGGG + Exonic
934740129 2:96714403-96714425 CAGTGGTGTTAAGAGGAGGACGG - Intronic
935236633 2:101144303-101144325 CAGTGGTGGGAGTAGGGGAAGGG + Intronic
935386799 2:102508123-102508145 CACTGGTCCTTGATGGAGAAGGG - Exonic
937773922 2:125753366-125753388 CAGTAGTGCTAGAAGAAAAAGGG - Intergenic
938640709 2:133275995-133276017 CAGGGGTGATAGAAGTGGAATGG - Intronic
940534808 2:154927240-154927262 AAGTGTTTCTAGAAGGAGAATGG + Intergenic
940682666 2:156806085-156806107 CAATCATGGTAGAAGGAGAAGGG + Intergenic
941087051 2:161130416-161130438 CAGTCATGGTAGAAGGTGAAGGG + Intergenic
943596830 2:189868350-189868372 CAGTTGTACTATATGGAGAATGG + Intronic
945045809 2:205780785-205780807 AAGTGCTGCTAAAAGGAGACAGG + Intronic
946367693 2:219259830-219259852 CAGTGCTGTGAGAAGGAGGATGG - Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947334304 2:229066018-229066040 CAATTGTGTTAGAAGTAGAAAGG - Intronic
947685757 2:232082927-232082949 CAGTCGTGGCAGAAGGTGAAAGG + Intronic
947777152 2:232722287-232722309 CAGTCATGGCAGAAGGAGAAGGG + Intronic
948365458 2:237451844-237451866 CAGGGGTGCCGGAAGGAGCATGG - Intergenic
1170982932 20:21231730-21231752 CAGTGTTGTTAGAAGTAGCAGGG + Intronic
1172039751 20:32035475-32035497 CAGGGGAGCTTGAAGGAGCATGG + Intergenic
1172795551 20:37534811-37534833 CAGTGGTGATATAAGAAGATGGG - Intergenic
1172859160 20:38033802-38033824 CAGGGGTGCGAGAAGGGGGAGGG - Exonic
1173732571 20:45338964-45338986 CAGTGGTGATAGGAGGACACAGG + Intronic
1173934063 20:46845933-46845955 CAGTGATGGTAGAAGGTGAAGGG + Intergenic
1174651481 20:52129479-52129501 CATTTTTGCTAGAAGGAAAAAGG - Intronic
1174746385 20:53067485-53067507 CAGGAGGGCTAGAAAGAGAAAGG - Intronic
1178155923 21:29854148-29854170 CACTTGTGGTAGAAGGGGAAGGG + Intronic
1178262806 21:31115817-31115839 CATTGTTGGTAGAAGGAAAAAGG - Intergenic
1178354620 21:31900234-31900256 CAGTGGGGCTGGAAGGAGCTAGG - Intronic
1179246415 21:39637729-39637751 CAGAGGTGCTAGAGAGACAATGG + Intronic
1179424522 21:41264532-41264554 CAATTGTGGTAGAAGAAGAAAGG + Intronic
1179637708 21:42724097-42724119 CAGAGGTGCTAGAGGGGGTAAGG + Intronic
1179681223 21:43022474-43022496 GAGTGGTCCTGGGAGGAGAAGGG + Intronic
1181581946 22:23833466-23833488 CAGTGCTGCTGGGAGGAGCAGGG + Intronic
1183347867 22:37317946-37317968 CAGTGGGGCCAGTAGGAGACAGG + Intergenic
1183756392 22:39770257-39770279 AAGAGGTGCTAGAGGGAGATGGG + Intronic
1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG + Intronic
950145725 3:10648389-10648411 CATTGATGCTGGGAGGAGAAAGG - Intronic
950822105 3:15771472-15771494 CAATGGTGGTAGAAGGCAAAAGG + Intronic
951293411 3:20902262-20902284 CAGTCATGGTAGAAGGTGAAAGG - Intergenic
951441603 3:22729937-22729959 CAGTGATGCTACAAGGCAAAAGG - Intergenic
951981386 3:28570868-28570890 CAGTGGTGCTAAACCTAGAAGGG + Intergenic
952621880 3:35354308-35354330 AAGAGGTGCTAAAAGCAGAATGG + Intergenic
954673837 3:52304905-52304927 CAGTGCTGCCAGGAGGAGAGAGG + Intergenic
956966565 3:74468533-74468555 CAGTGGTGCTGGTATTAGAATGG - Intronic
957174336 3:76786417-76786439 CAGTGATGGCAGAAGGTGAAGGG + Intronic
957212075 3:77272348-77272370 CAGTCGTGGCAGAAGGTGAAGGG + Intronic
958885494 3:99721611-99721633 CAGTTGTAATAGAAGAAGAATGG + Intronic
959411506 3:106029166-106029188 CAGTCGTGGTGGAAGGGGAATGG - Intergenic
959718720 3:109462603-109462625 CAATTGTGGTAGAAGGTGAAGGG - Intergenic
962345651 3:134617427-134617449 CAGGGGAGGTAGAAGGAGAGAGG + Intronic
963031931 3:140987363-140987385 CAGTTGTGGTCGAAGGGGAAGGG - Intergenic
963362303 3:144289934-144289956 CAGTGGTCCAAGGGGGAGAATGG + Intergenic
963829692 3:149993288-149993310 CAATGGTGGTAGACGGGGAAGGG - Intronic
964914717 3:161826600-161826622 CAATGGTCCTGGAAGGAGAAAGG - Intergenic
965341931 3:167502187-167502209 CAGTGGTGGTGGAAGGTGAAGGG - Intronic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
968359976 3:198139860-198139882 GAGGGGTGGGAGAAGGAGAAGGG + Intergenic
968958980 4:3733309-3733331 CAGTGGAGCTTGAGGGAGCAGGG + Intergenic
969229701 4:5821450-5821472 CAGTGGAGTTAGAAGTGGAAGGG + Exonic
969476312 4:7424403-7424425 CAGTGATGCCAGAGGGACAACGG - Intronic
970054721 4:11957628-11957650 AAGTGCTGATAGAAGGAGATTGG - Intergenic
970108616 4:12612843-12612865 CAGTGGTGCCAAAAGTAGAGAGG - Intergenic
970653283 4:18201519-18201541 CAGTTGTGGTGGAAGGTGAAAGG + Intergenic
972363023 4:38346281-38346303 CAATTGTGGCAGAAGGAGAAAGG - Intergenic
972557821 4:40198233-40198255 AAGTGTCGGTAGAAGGAGAAGGG + Intronic
974454863 4:62115926-62115948 CAGTGTTGATGAAAGGAGAAAGG + Intergenic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
974624506 4:64405337-64405359 CAGGAGTGCTAGAAGTAGAAGGG + Intronic
974834905 4:67236711-67236733 CAGTGGGGCTATGAAGAGAAAGG + Intergenic
975247462 4:72136290-72136312 CAGTGGTGGTAGGAGCAGAGGGG + Intronic
976607910 4:86999831-86999853 CAGTGATGGCAGAAGGAGACTGG + Intronic
977635590 4:99294064-99294086 CAGTGGAGGTAGCAGGAGAGTGG - Intergenic
979280944 4:118866787-118866809 CAGTCGTGGCTGAAGGAGAAGGG - Intronic
979538664 4:121854103-121854125 GAGTGATGGTAGAAGGAGGAGGG - Intronic
979690545 4:123554258-123554280 CAGTGGTTCTAGTAGAAGTAAGG - Intergenic
979876700 4:125900629-125900651 CAGTCGTGGTGGAAGGTGAACGG + Intergenic
980126812 4:128782246-128782268 CAATGGTGTGAGAAGAAGAAAGG + Intergenic
980277755 4:130677067-130677089 CAGTCATGGTAGAAGGTGAAAGG - Intergenic
980761659 4:137241483-137241505 CAGTTATGGTAGAAGGGGAAGGG - Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981353908 4:143765169-143765191 CAATGGTGGCAGAAGGGGAAAGG + Intergenic
982173930 4:152687639-152687661 CAGTGGTTCCTGCAGGAGAAGGG - Intergenic
984830410 4:183967457-183967479 GAGTGGTGCAAGAGGAAGAAAGG + Intronic
987914332 5:24191714-24191736 CAGTCATGGTGGAAGGAGAAAGG - Intergenic
988006870 5:25424725-25424747 CAGTATTGCTAGAAGGAAAATGG + Intergenic
988019765 5:25607991-25608013 TGGTGGTGCTAAAAGGAGGAGGG + Intergenic
988361048 5:30237029-30237051 CAGTGGGGCTAGAATGAAATAGG + Intergenic
988648265 5:33120362-33120384 TAGTGGTGGAATAAGGAGAAAGG - Intergenic
988850363 5:35174522-35174544 CAGTGTTGTTTGAAAGAGAAAGG - Intronic
989210255 5:38851947-38851969 CAGTCATGGTGGAAGGAGAAAGG - Intronic
989503841 5:42202566-42202588 CAGTGAAGATAGAAGGTGAAAGG + Intergenic
990760098 5:59119563-59119585 CAGTGGTGCTAATATGACAAAGG + Intronic
990884558 5:60576563-60576585 CAGTCATGATAGAAGGCGAAGGG + Intergenic
991090888 5:62692861-62692883 CAGGGGTGCTTGAAGATGAATGG - Intergenic
992033261 5:72745726-72745748 CAGTTGTGGTGGAAGGTGAAGGG + Intergenic
992162973 5:74020460-74020482 CAGTGGTGACAGAAAGAAAATGG + Intergenic
992411049 5:76505449-76505471 CTGTGATGCTACAGGGAGAATGG + Intronic
992762695 5:79965115-79965137 CTGTGGTCTTAGCAGGAGAAAGG - Intergenic
992843085 5:80715682-80715704 CAGTCGTGGCAGAAGGTGAAGGG + Intronic
993662482 5:90654897-90654919 TAGTGGTGGTGGAATGAGAATGG + Intronic
994019430 5:95005665-95005687 CAGTCATGGTAGAAGGTGAAGGG - Intronic
994117519 5:96077725-96077747 CACTCATGGTAGAAGGAGAAGGG - Intergenic
995444836 5:112231350-112231372 CAGTGCTACTACAAGTAGAATGG + Intronic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
997729848 5:136161034-136161056 ATGTGCTGCTAGCAGGAGAAGGG - Exonic
999020584 5:148161593-148161615 CCGCAGTGCTAGAATGAGAATGG - Intergenic
999418972 5:151424327-151424349 CAGTGATGCTGGAGGAAGAAAGG + Intergenic
1000850867 5:166339029-166339051 CACTGGTGTTATAATGAGAATGG + Intergenic
1001791852 5:174464502-174464524 GAGTGGTTCTGGAAGGAGGAAGG - Intergenic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1003575689 6:7292414-7292436 CAGTGGTGATAGGAGTAAAAGGG - Intronic
1003652143 6:7970597-7970619 CAGTGATGGTGGAAGGTGAAGGG - Intronic
1003819387 6:9878800-9878822 CTGTGGTGCTAGAAGCAATATGG - Intronic
1003894238 6:10591665-10591687 GAGTGGTACTAGCAGGAGGAGGG - Intronic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1006944763 6:37777918-37777940 AGGGGGTGGTAGAAGGAGAAGGG + Intergenic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1007586713 6:42995072-42995094 GACTGGTGCTAGAAGAAGAGTGG - Intronic
1009974441 6:70657997-70658019 CAGTGCTGCTAGAAGAAGGGAGG + Intergenic
1010165139 6:72906243-72906265 CAGTGCTGCTAGCAGGGGCATGG - Intronic
1010704088 6:79087134-79087156 CAGTCGTGGTGGAAGGCGAAGGG - Intergenic
1011344365 6:86352801-86352823 CAGTGGGGCCAAATGGAGAATGG - Intergenic
1012079523 6:94737377-94737399 CTGGGGTCTTAGAAGGAGAAAGG - Intergenic
1013576678 6:111490187-111490209 CAGAGGTGCTAGAAGATAAATGG - Intergenic
1013928839 6:115504819-115504841 CAGTAGTGGTGGAAGGGGAAAGG - Intergenic
1014830056 6:126092334-126092356 CAGTCATGGTGGAAGGAGAAAGG + Intergenic
1015023548 6:128506108-128506130 CAATGGTTATAGAATGAGAAAGG - Intronic
1019260013 7:76760-76782 GAGGGGTGGGAGAAGGAGAAGGG - Intergenic
1020230957 7:6318091-6318113 CAGTGGCTCTAGAGGGAGAGGGG + Intergenic
1020550864 7:9602798-9602820 CTGTGGTGGCAGAAGGTGAAAGG - Intergenic
1020774472 7:12435780-12435802 CAGTCGTGGTGGAAGGTGAAAGG + Intergenic
1021056617 7:16056132-16056154 CAGTGATGGTGGAAGGTGAAGGG + Intergenic
1021519822 7:21527799-21527821 CAGTCGTGGTGGAAGGTGAAGGG - Intergenic
1021659419 7:22904986-22905008 CAATCGTGGTAGAAGGAGAAAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1027673721 7:81133520-81133542 CAGTCATGGTGGAAGGAGAAGGG - Intergenic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028631316 7:92937440-92937462 CAGAGGTGGGAGAAGGGGAAAGG - Intergenic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029679701 7:102099821-102099843 CACCAGTGATAGAAGGAGAAGGG - Intronic
1029930939 7:104370385-104370407 CGGTGGTGCTAGAGGGAGCCTGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030170780 7:106600641-106600663 CAATGGTAATAAAAGGAGAATGG + Intergenic
1030615961 7:111738592-111738614 CAGTGATGCTAAAAGGGAAATGG - Intronic
1030861674 7:114639440-114639462 CAGTTGTATTAGAAGGAGACTGG + Intronic
1031339569 7:120582274-120582296 AAGAGGTGCTAGTAGGAGAAGGG - Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1033609240 7:142950117-142950139 GAGTGATGTGAGAAGGAGAATGG - Intronic
1033790784 7:144790526-144790548 CAATCGTGGCAGAAGGAGAAGGG + Intronic
1034316060 7:150134381-150134403 CAGTGGTGAAAGAGAGAGAAGGG - Intergenic
1034375594 7:150641217-150641239 CAATCATGGTAGAAGGAGAAGGG - Intergenic
1034628446 7:152512208-152512230 CACTGGTGATAGAAGCAGAGGGG + Intergenic
1034790828 7:153966400-153966422 CAGTGGTGAAAGAGAGAGAAGGG + Intronic
1036012166 8:4738393-4738415 AAATGGTGGCAGAAGGAGAAGGG + Intronic
1036673328 8:10807807-10807829 CAGAGGAGCTAAAAGGAGCAAGG + Intronic
1037636049 8:20701756-20701778 CAGTGGGGCTGGCAGGAGCAGGG + Intergenic
1038027324 8:23603337-23603359 CATTGAGGCAAGAAGGAGAAAGG - Intergenic
1038159503 8:25023266-25023288 CAGTGGTGCTCTGAGGAGAAAGG - Intergenic
1040705650 8:50123338-50123360 CAGTGTTCCTGAAAGGAGAATGG + Intronic
1041097275 8:54362119-54362141 CAGTGGTGCTAGCAGGAGCTTGG + Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1043640558 8:82444859-82444881 CTGTGGTGCTAGAATAAAAAAGG + Intergenic
1044189454 8:89297611-89297633 CAGTGGTGGCAGAAGGCAAAGGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1047307581 8:123665425-123665447 AAGTGGGGCTACAAGGAGACTGG + Intergenic
1047675453 8:127196840-127196862 CAGTGGTGCTGGGGCGAGAAGGG + Intergenic
1048783923 8:138030507-138030529 CAGTCGTGGTGGAAGGTGAAGGG - Intergenic
1050064630 9:1746148-1746170 CAATTGTGGCAGAAGGAGAAAGG - Intergenic
1050444283 9:5702412-5702434 CAGTCATGACAGAAGGAGAAGGG + Intronic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1052127937 9:24801744-24801766 CAGTCGTGGCAGAAGGTGAAGGG - Intergenic
1052443502 9:28529156-28529178 CTGAGGTACTGGAAGGAGAATGG - Intronic
1053414326 9:37937505-37937527 CACTCGTGCTGGAAGGAGGATGG + Intronic
1056065971 9:82935038-82935060 CACTGGGGCCAGAAGAAGAATGG + Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058139276 9:101340851-101340873 CACTCATGGTAGAAGGAGAAGGG + Intergenic
1058782704 9:108354244-108354266 CAGTCATGGCAGAAGGAGAAGGG - Intergenic
1059957426 9:119532844-119532866 TAGGGGTGCTAGAAAGAAAATGG - Intergenic
1060557469 9:124516029-124516051 CAGAGGTGCCGGGAGGAGAAGGG - Intergenic
1060852397 9:126888662-126888684 CCGGAGTGCTAGAAGTAGAAGGG + Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061223027 9:129263252-129263274 CACAGGTGCTGGATGGAGAAAGG + Intergenic
1061640265 9:131948647-131948669 CAGTTGTGTTAGGATGAGAAGGG - Intronic
1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG + Intronic
1062744684 9:138203704-138203726 GAGGGGTGGGAGAAGGAGAAGGG + Intergenic
1185575449 X:1168882-1168904 GAATGGTACTAGAAAGAGAAGGG + Intergenic
1185679769 X:1879059-1879081 CAGTCATGGTGGAAGGAGAAAGG + Intergenic
1186230155 X:7445077-7445099 CTGTGGTGACAGAAGGGGAAGGG - Intergenic
1187077568 X:15950566-15950588 CAATGGTTCTAAATGGAGAAAGG - Intergenic
1187259723 X:17674038-17674060 CAGAGGTGCTTTAAAGAGAAAGG - Intronic
1188580078 X:31701039-31701061 CTGTGGTGCTAGAATTATAATGG - Intronic
1189307887 X:40000832-40000854 CAGTGGGGTAAGAAGGAGAGGGG + Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1192102929 X:68284391-68284413 CAGTGGTGGCAGAAGAAGAAAGG - Intronic
1192208663 X:69112812-69112834 CTCTGGTGCTAGAAGGGGAACGG + Intergenic
1192751181 X:73993260-73993282 CAGTGGTGCTAGAAGATAAATGG - Intergenic
1193728040 X:85066357-85066379 TAGTGGTGCTATCAGGATAAAGG + Intronic
1193943702 X:87707341-87707363 CAGTGGTAGTAGATGGGGAAGGG + Intergenic
1195070454 X:101273934-101273956 CAGTGGTGCTATTAGAATAAAGG - Intronic
1196038683 X:111176320-111176342 CACTGGGGCCAGAAGGGGAATGG + Intronic
1196247920 X:113422538-113422560 CACTGGTGGTAGAAGGTGAAGGG - Intergenic
1196525107 X:116722008-116722030 CAGAGTTGATATAAGGAGAAAGG + Intergenic
1197766602 X:130063394-130063416 GAGTGGTGGCAGAAGGAGCAGGG + Intergenic
1198596098 X:138237442-138237464 CAATGGTGATAAAAGGAAAATGG + Intergenic
1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG + Intergenic
1201653335 Y:16315603-16315625 TAATGATGGTAGAAGGAGAAAGG + Intergenic
1202140177 Y:21713463-21713485 CAGTGGTGCTAGAGGAATTAAGG - Intergenic