ID: 981110080

View in Genome Browser
Species Human (GRCh38)
Location 4:140925265-140925287
Sequence AGGTGAAGCCTGCAAACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981110080_981110087 21 Left 981110080 4:140925265-140925287 CCACCAGTTTGCAGGCTTCACCT 0: 1
1: 0
2: 0
3: 17
4: 191
Right 981110087 4:140925309-140925331 CCCTGGAGCATCAAGCCAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 159
981110080_981110085 4 Left 981110080 4:140925265-140925287 CCACCAGTTTGCAGGCTTCACCT 0: 1
1: 0
2: 0
3: 17
4: 191
Right 981110085 4:140925292-140925314 CAGTTCTGGGAAAGTCTCCCTGG 0: 1
1: 0
2: 0
3: 16
4: 166
981110080_981110083 -9 Left 981110080 4:140925265-140925287 CCACCAGTTTGCAGGCTTCACCT 0: 1
1: 0
2: 0
3: 17
4: 191
Right 981110083 4:140925279-140925301 GCTTCACCTGATACAGTTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 163
981110080_981110082 -10 Left 981110080 4:140925265-140925287 CCACCAGTTTGCAGGCTTCACCT 0: 1
1: 0
2: 0
3: 17
4: 191
Right 981110082 4:140925278-140925300 GGCTTCACCTGATACAGTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981110080 Original CRISPR AGGTGAAGCCTGCAAACTGG TGG (reversed) Intronic
902058160 1:13619284-13619306 AGGAGATGACTGGAAACTGGGGG + Intergenic
902333318 1:15741524-15741546 AGGTGAGGCCTGCCACCTAGTGG + Intergenic
903464077 1:23539979-23540001 AGGTGAAGGCTGCCACCTAGAGG + Intergenic
906149333 1:43578395-43578417 GGGAGCAGCCTGCAGACTGGCGG - Intronic
906321257 1:44818347-44818369 AGCTGATGGCTGTAAACTGGGGG + Intergenic
909150502 1:71996945-71996967 AGGTGGAGGGAGCAAACTGGAGG - Intronic
909540475 1:76785972-76785994 AGGTCAGGCTTGCAAACTGGTGG - Intergenic
909905364 1:81187663-81187685 AGGAAAAGTCTTCAAACTGGTGG - Intergenic
916543923 1:165784257-165784279 CTGTGAAGCCTGCCACCTGGAGG - Intronic
917442930 1:175082789-175082811 AGGGGAAGCCTGAGAATTGGAGG + Intronic
918512145 1:185322869-185322891 AGGAGAAGCTAGCAGACTGGAGG - Intergenic
923066380 1:230521130-230521152 ATCTGAAGCCTGCTACCTGGAGG - Intergenic
1067341457 10:45408518-45408540 ACCTGAAGCCTGCTACCTGGAGG - Intronic
1068972647 10:62975576-62975598 AGGTGAGGGATTCAAACTGGAGG + Intergenic
1069854830 10:71434337-71434359 AGGTAAAGCCCGCACCCTGGGGG - Intronic
1074101403 10:110357300-110357322 TGGTCAAGCCTTCAAAGTGGAGG + Intergenic
1074426234 10:113353901-113353923 AAGTGAGGACTGCAAGCTGGTGG + Intergenic
1076493839 10:130883801-130883823 AGGTGACTATTGCAAACTGGAGG + Intergenic
1085710341 11:78823595-78823617 AGCTGAAGCCTGGAAAGAGGCGG + Intronic
1085856495 11:80181672-80181694 AGGAGAGGCCTGCAAACTAAGGG + Intergenic
1087293036 11:96340437-96340459 GGGGGAAGCCTGCAAACAGCAGG + Intronic
1087561545 11:99796626-99796648 AGGTGAGGCCAGCAGACAGGGGG + Intronic
1087819890 11:102699932-102699954 ATGTCAAGCCTGAGAACTGGAGG - Intronic
1088976089 11:114817637-114817659 AGGGGAAGCAGGCAAACTGAAGG + Intergenic
1089086136 11:115818468-115818490 AGGAGAAGCCAGCAAGCTGAAGG + Intergenic
1093058318 12:14577364-14577386 AGGTGGATCCTGCAACCTTGGGG + Intergenic
1094468372 12:30778953-30778975 AGGTGAAGCCTCCAAATAGCAGG + Intergenic
1095255590 12:40032070-40032092 GGGTGGGGCCTGGAAACTGGTGG - Intronic
1096547050 12:52347256-52347278 AGGTGTAGCCTACATCCTGGTGG - Intergenic
1097201254 12:57280721-57280743 AGCAGAAGCCTGCAAAGAGGAGG - Intronic
1098856038 12:75654313-75654335 AGGACAGCCCTGCAAACTGGAGG + Intergenic
1102960552 12:117090772-117090794 GGGTGAGGCCTGCAAAGTGCTGG + Intronic
1103269806 12:119663924-119663946 AGGTGAGGCCTCCAACATGGTGG + Intergenic
1104536023 12:129619052-129619074 AGGTGAAGCCTCCAAATAGCAGG + Intronic
1104814869 12:131639797-131639819 AGGTGCTGCTTGTAAACTGGAGG + Intergenic
1106185757 13:27408389-27408411 AGGTGAAGCCTGTTAGGTGGAGG + Intergenic
1106983021 13:35312565-35312587 AGGTGTGGCCTGCAATGTGGAGG + Intronic
1108679158 13:52764570-52764592 AGCTGCAGCCTGCAAGGTGGTGG - Intergenic
1109997507 13:70148102-70148124 ATCTGAAGCCTGCTACCTGGAGG - Intergenic
1112631740 13:101168977-101168999 AGGTGCAGACTGAAATCTGGAGG - Intronic
1113535648 13:111064329-111064351 CTGTGAAGCCTGCTACCTGGAGG + Intergenic
1113919920 13:113901486-113901508 AGGTGGGGCCTGCCAGCTGGGGG + Intergenic
1115448774 14:33522362-33522384 AGGTGAACTCTGCAATGTGGCGG - Intronic
1116151222 14:41144955-41144977 ACGTGAGACCTGCAAAATGGTGG - Intergenic
1117344553 14:54819535-54819557 AGGTGGAGATTGCAAACTGGTGG - Intergenic
1117959267 14:61147147-61147169 AGCTGTAGACTGGAAACTGGAGG - Intergenic
1118948469 14:70411363-70411385 AGGTAAAGCCTGCTTCCTGGAGG + Intronic
1119479559 14:74951062-74951084 CGGGAAAGGCTGCAAACTGGTGG + Intronic
1119661405 14:76454644-76454666 TGCTGGAGCCTACAAACTGGAGG + Intronic
1120310854 14:82826649-82826671 GGGTGATGCCTGGAAACTGGAGG + Intergenic
1120970518 14:90203308-90203330 CTCTGAAGCCTGCAACCTGGAGG + Intergenic
1121993089 14:98580194-98580216 AGGTGAAGGATGCACAATGGAGG + Intergenic
1122275622 14:100589346-100589368 AGCTGAAGCCTGCAAGCTGCTGG - Intergenic
1122797332 14:104212585-104212607 AGGTGAGGCCTGGAAACCTGAGG - Intergenic
1126234502 15:46367755-46367777 AGGTGGATCCTGGTAACTGGAGG + Intergenic
1126297014 15:47150939-47150961 AGGTGGAGCCTGGAGCCTGGTGG - Intergenic
1127305806 15:57704872-57704894 CTCTGAAGCCTGCTAACTGGAGG + Intronic
1131020029 15:89089547-89089569 AGGTGAAACTGACAAACTGGAGG - Intronic
1135284240 16:21179791-21179813 AGGTCAAGTCTGCATACTTGGGG - Exonic
1135478776 16:22803067-22803089 AGCTGAAGACTCAAAACTGGAGG + Intergenic
1137613234 16:49833007-49833029 AGATGAAGGCTGCGAACTGGAGG - Intronic
1137854262 16:51777965-51777987 AGGTGCCTCCTGCAAAGTGGAGG + Intergenic
1137982914 16:53084932-53084954 AGGTTAGGGTTGCAAACTGGGGG + Intronic
1140566545 16:76049225-76049247 AGGAGACGCCAGCAAACAGGGGG + Intergenic
1141438661 16:84015301-84015323 AGGGGAAGCCAGCAAGGTGGGGG - Intronic
1141576682 16:84968509-84968531 GGGTTAAGACTGCAAGCTGGTGG - Intergenic
1142106306 16:88304848-88304870 AGGTGCTGCCTGCACCCTGGAGG + Intergenic
1146146600 17:30424281-30424303 CTGTGAAGCCTGCTACCTGGAGG - Intronic
1147602665 17:41755701-41755723 AGGAAAAGCCTGCAAAGAGGGGG + Exonic
1149003424 17:51779845-51779867 AGGAGAAGGCTGGAAACTTGGGG + Intronic
1151658490 17:75506778-75506800 AGGTGAGGCCTGCAGCCTTGGGG - Exonic
1152388957 17:79991776-79991798 AGGGGAAGCCTGCCATCTGCTGG + Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154385810 18:13890916-13890938 AAGAGGAGCCTGCAGACTGGAGG + Intronic
1155302902 18:24449009-24449031 GGGTCAGGCCTGTAAACTGGTGG + Intronic
1156012771 18:32513278-32513300 TGGTGAAGCCTACAAACTCCAGG - Intergenic
1160052438 18:75447513-75447535 TACTGAAGCCTGAAAACTGGGGG + Intergenic
1160541869 18:79628387-79628409 TGGAGACGCCTGCAAAGTGGAGG + Intergenic
1160548372 18:79677428-79677450 AGGTGAGGCCTGCAAACAGCAGG + Intergenic
1163493189 19:17629284-17629306 AGATGATGTCTGCATACTGGAGG + Exonic
1163861205 19:19743837-19743859 AGGTGAAGGCCGAGAACTGGTGG + Intergenic
1164647938 19:29873077-29873099 AGGTGAAGGCTGCAGAATGGGGG - Intergenic
1164786490 19:30935259-30935281 AGGAGAAGCCTGCACATTGCAGG + Intergenic
1165005478 19:32802908-32802930 AGGAGAACCCTGAAAATTGGGGG - Intronic
1165635153 19:37334200-37334222 CGGTGTCGCCTCCAAACTGGTGG + Intronic
1165981620 19:39729032-39729054 AGGTGAATTCTGCACAGTGGAGG - Intergenic
1166972959 19:46582662-46582684 AGGTGAAGCCTGAGACCTGGTGG + Intronic
1167036014 19:46995426-46995448 TGGTGAAGCCAGCACCCTGGAGG + Intronic
1167118853 19:47504520-47504542 AGGTGAAGCCTGCAGAAGGAGGG + Intronic
1167586608 19:50378914-50378936 AGGCCAAGCCTGCACCCTGGGGG - Intronic
1202647225 1_KI270706v1_random:153315-153337 AGGTGCTGCCTGCACACAGGGGG + Intergenic
925091939 2:1163268-1163290 ACGTGAAGCCTCCCAACAGGAGG + Intronic
925091975 2:1163437-1163459 ACGTGAAGCCTCCCAACAGGAGG + Intronic
925755777 2:7131056-7131078 AGGTGAAAAGTGCAAACTGCTGG + Intergenic
925966061 2:9067193-9067215 AGGTGATGTCTGCAAGATGGTGG - Intergenic
927746238 2:25624062-25624084 AGATGAAGCCTGCAAATAGTAGG - Intronic
928333058 2:30372352-30372374 AGGTGCAGCCAGCTAAGTGGTGG - Intergenic
929518155 2:42623295-42623317 AGGTGGAGGCTGCTAAGTGGTGG + Intronic
929876904 2:45804337-45804359 GGGTGGGGCCTGCACACTGGTGG - Intronic
933432389 2:82199689-82199711 CTCTGAAGCCTGCAACCTGGAGG + Intergenic
934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG + Intergenic
936973084 2:118193267-118193289 AGGGGAACCCTGCAGATTGGAGG + Intergenic
939147063 2:138428613-138428635 AGATAAAACCTGCAAACTTGAGG - Intergenic
946149812 2:217756709-217756731 AGGTGAAGACTGCCCCCTGGTGG + Intergenic
948579223 2:238972564-238972586 AGTTGAAACCTGCCAAGTGGTGG - Intergenic
948865547 2:240773003-240773025 GGGTGCAGCCAGCAAAGTGGTGG + Intronic
948884131 2:240874534-240874556 AGCTGCAGCCTGGCAACTGGAGG + Intronic
948995506 2:241576260-241576282 AGTTGAAGGCTGCAGACAGGAGG - Intergenic
1172063722 20:32205303-32205325 AGGGGAAGACTGCATTCTGGGGG - Intronic
1175762698 20:61572105-61572127 AAGTGAAGCCTGCATTCTGGAGG - Intronic
1176257568 20:64160145-64160167 AGGTCCAGCCTGAAACCTGGTGG - Intronic
1177572034 21:22899729-22899751 AAGTGAAGCCTGTCAAATGGAGG + Intergenic
1179033476 21:37740334-37740356 CTCTGAAGCCTGCAACCTGGAGG + Intronic
1180062358 21:45392143-45392165 TTGTGAGGGCTGCAAACTGGAGG - Intergenic
1180732793 22:17994474-17994496 AGGTGATCCCTGCAAAGTGCTGG - Intronic
1181119386 22:20655430-20655452 AGGTGAGGCCTGGGAACAGGTGG - Intergenic
1181673519 22:24437184-24437206 AGGGGCAGCCTGCAAGCCGGGGG + Intronic
1184927119 22:47650713-47650735 AGGTGAAGACTCAAAGCTGGTGG + Intergenic
1185121729 22:48975362-48975384 ACGTGGAGCCTGGAAGCTGGGGG - Intergenic
950357981 3:12427823-12427845 AGGTGTGGGCTGAAAACTGGAGG - Intronic
950694144 3:14684456-14684478 ATGTCAAACCTTCAAACTGGGGG - Intronic
951931977 3:27977838-27977860 AGGTGAAGTCTCCAAATTGCTGG - Intergenic
955909807 3:63848268-63848290 CTGTGAAGCCTGCTAGCTGGAGG + Intronic
956983549 3:74669138-74669160 TGATGAAGCCAGCAAAATGGGGG - Intergenic
957208980 3:77236323-77236345 CTGTGAAGCCTGCAACCTAGAGG - Intronic
957407464 3:79790317-79790339 AGGTGAACATTGCAAACTGTCGG + Intergenic
962739828 3:138355320-138355342 AGGAGAAGGCTGCAAACAGTTGG - Intronic
965752262 3:171988231-171988253 ATGTAAAGGCAGCAAACTGGGGG - Intergenic
966927234 3:184652669-184652691 ATGTGAAGGCTGCAAAACGGGGG - Intronic
969346355 4:6572950-6572972 CTCTGAAGCCTGCTAACTGGAGG + Intergenic
969411981 4:7034431-7034453 AGGTGGTGCCTGCACACAGGAGG - Intergenic
974225659 4:59039449-59039471 AGGCTAAGCCTGTAACCTGGGGG + Intergenic
975318148 4:72978852-72978874 AGGAGAAGCCAGAAATCTGGTGG - Intergenic
977802075 4:101246882-101246904 AGGAGAAGCCTGCAAATTCAAGG - Intronic
978322720 4:107515883-107515905 AGGTGCAGGGTGCAAACTGTTGG - Intergenic
981110080 4:140925265-140925287 AGGTGAAGCCTGCAAACTGGTGG - Intronic
982010464 4:151100903-151100925 AAGTCAAGCCTGTAAACTGAGGG - Intronic
986065936 5:4233856-4233878 AGGTGGAGCCTGCTGACTGGTGG - Intergenic
986313866 5:6573229-6573251 AGGTGCACCCTGCGCACTGGAGG + Intergenic
987062454 5:14255493-14255515 AGATGAGTCATGCAAACTGGAGG + Intronic
988498588 5:31765344-31765366 AGGTTGAGGCTGCAAACTAGAGG - Intronic
988809227 5:34768030-34768052 AGGTGAACGGTGCAAACTGTCGG - Intronic
991487923 5:67157163-67157185 TTGTGAAGCCTGCCACCTGGTGG - Intronic
991644869 5:68791719-68791741 CTGTGAAGCCTGCTACCTGGAGG - Intergenic
992172179 5:74114218-74114240 AGGTGGAGGTTGCAAGCTGGTGG + Intergenic
994333601 5:98537895-98537917 AAGAGAAGACTGAAAACTGGAGG + Intergenic
994829374 5:104759485-104759507 CTGTGAAGCCTGCTAAGTGGAGG + Intergenic
998266992 5:140673717-140673739 AGGTGAAAGCTGCAAAGTCGCGG + Exonic
1000235150 5:159351285-159351307 ATCTGAAGCCTACAAGCTGGGGG - Intergenic
1001827890 5:174760725-174760747 AGCAGCAGTCTGCAAACTGGAGG - Intergenic
1002001143 5:176196867-176196889 AGGTGAAGCCTGCGGCCTGATGG + Intergenic
1002253192 5:177942105-177942127 AGGTGAAGCCTGCGGCCTGATGG - Intergenic
1002522368 5:179798859-179798881 CGGTGAAGCCTACACCCTGGGGG + Intronic
1005596663 6:27384924-27384946 AGGAGAAGCCTGAACACGGGAGG + Intronic
1013088325 6:106875638-106875660 AGGTGCAGGCTGCAAACTGCTGG + Intergenic
1013237128 6:108207008-108207030 AGGTGAAGCCCACGAACTTGTGG + Intergenic
1015346363 6:132164152-132164174 AGGTGCAGCCTGCGCTCTGGAGG - Intergenic
1018679998 6:166256595-166256617 AGGTAAAGTCTGCAAAGTGCAGG + Intergenic
1020124736 7:5527064-5527086 GGGTGAACCCTGCAAAAGGGTGG - Intergenic
1020197711 7:6054880-6054902 AGCTGAATCCTGGAAGCTGGAGG + Intronic
1022484303 7:30765999-30766021 AGGTGAGGCCTGCTACATGGGGG - Intronic
1023378717 7:39584917-39584939 AGGTGGAGGCTGCTAAGTGGAGG - Intronic
1024276448 7:47680835-47680857 AGATGAAGCCTGCTACCTGGAGG + Intergenic
1024388411 7:48779837-48779859 CTCTGAAGCCTGCTAACTGGAGG - Intergenic
1030401683 7:109059353-109059375 AGGAGAAGCCAGCAGACAGGAGG + Intergenic
1031732908 7:125320210-125320232 AGGTGCAGGGTGCAAACTGTTGG - Intergenic
1034191345 7:149215745-149215767 GGGGGAAGCCAGGAAACTGGTGG + Intronic
1034334683 7:150313481-150313503 CTGTGAAGCCTGCTACCTGGAGG - Intronic
1034828393 7:154287801-154287823 AGGTGAGGCCTGCATCCTGGAGG + Intronic
1035178788 7:157074281-157074303 AGGTCAAGCCTGAAAACTTCAGG + Intergenic
1035359915 7:158304776-158304798 CTCTGAAGCCTGCAACCTGGAGG - Intronic
1036287428 8:7456237-7456259 AGGTCAAGCCTGCAGAGTTGCGG + Intronic
1036334052 8:7855288-7855310 AGGTCAAGCCTGCAGAGTTGCGG - Intronic
1036827607 8:11990368-11990390 CTCTGAAGCCTGCAAACTAGAGG + Intergenic
1037415859 8:18649167-18649189 AGGTGCAGGGTGCAAACTGCTGG - Intronic
1038118660 8:24586767-24586789 ACCTGAAGTCTGCAAGCTGGAGG - Intergenic
1038587155 8:28800289-28800311 AGGGGAAGCATGCAGACTGCAGG + Intronic
1038794614 8:30698865-30698887 AGGTGATGCCTGGAAACAGGTGG - Intronic
1039401304 8:37271930-37271952 AGGTCAAGCCTGCACCTTGGAGG + Intergenic
1039501354 8:38020151-38020173 ATCTGAAGCCTGCTACCTGGAGG - Intergenic
1039595139 8:38785109-38785131 AGCTGAAGCCTGGGAACTTGGGG + Intronic
1041805347 8:61843425-61843447 CTCTGAAGCCTGCTAACTGGAGG + Intergenic
1041854947 8:62440988-62441010 AGATGAAGCCTTCAAAATGGAGG - Intronic
1043090588 8:75897265-75897287 AAATGAAGCCTTCAAAGTGGAGG + Intergenic
1044558560 8:93590569-93590591 AGGTCAAGCCTGCATGCTGGAGG - Intergenic
1047164313 8:122420091-122420113 AGGAGAAGCGTACAAACTTGGGG - Intergenic
1049959943 9:728693-728715 AGATGAAGCCTGCTACCTGGAGG + Intronic
1051171648 9:14323048-14323070 AGTTGAAGCCAGCAACGTGGCGG - Intronic
1052569667 9:30203353-30203375 AGTTGAAGACTGCAAACTCATGG - Intergenic
1054721447 9:68608130-68608152 TGGTGAACCCTGCAATTTGGAGG + Intergenic
1055616923 9:78082705-78082727 AGGTGAAGCCAGCAAAGAAGAGG - Intergenic
1057300226 9:93874269-93874291 AGGTGCAGGGTGCAAACTGCTGG + Intergenic
1058266870 9:102911298-102911320 ACGTGAAGCCTGTTGACTGGGGG + Intergenic
1059678056 9:116559114-116559136 TGGTGAAGCCTACAACCTGTGGG + Intronic
1060400301 9:123344660-123344682 TGGTAAGGCCTGCAAACTGCCGG - Intergenic
1060721568 9:125983137-125983159 AGGTGAAGCCGGGAAACTCCAGG - Intergenic
1060818553 9:126648703-126648725 AGATGAGGCCTGGAATCTGGGGG + Intronic
1061704702 9:132444073-132444095 AGGTGGAGCCTTCACCCTGGTGG - Intronic
1185737442 X:2503991-2504013 GGGTGCAACCTGCACACTGGGGG - Intergenic
1186569711 X:10701408-10701430 AGGGGAAGCTGGGAAACTGGGGG - Intronic
1189160719 X:38805595-38805617 AAGGGCAGACTGCAAACTGGGGG + Exonic
1192560708 X:72126220-72126242 ACGGGAATCCTGCAAGCTGGAGG + Intergenic
1193682771 X:84541944-84541966 AGGTGCAGGGTGCAAACTGTTGG - Intergenic
1194590841 X:95798007-95798029 AGGTGAAGGGTGCAAGCTGCTGG - Intergenic
1197703467 X:129616969-129616991 AGGTGGAGCATGCGAAGTGGGGG + Intergenic
1199061325 X:143358514-143358536 AGGTGGGAACTGCAAACTGGAGG + Intergenic
1199877577 X:151946586-151946608 AGAGGTAGCCTGCACACTGGAGG - Intergenic
1201783948 Y:17752991-17753013 AGGTGGAGCCTGACAACTGTGGG - Intergenic
1201817605 Y:18152996-18153018 AGGTGGAGCCTGACAACTGTGGG + Intergenic